RNU6B

TOOL miRNA RT-qPCR primer/probe set is an integral part of TOOL miRNA RT-qPCR assay which is based on two-step RT-qPCR to especially target microRNAs. Each TOOLS miRNA RT-qPCR primer/probe set is packaged including two parts: one tube containing the unique designed stem-loop RT primer and the other containing a mix of the qPCR probe, forward, and reverse primers. 
No. Size Price Qty
TTH-RNU6B 50 rxns. $250.00
TTH-RNU6B 250 rxns $850.00
The price does not include shipping fee and tax. ORDER
Features
  • Comprehensive: quantitate only mature miRNAs, not precursors
  • Sensitive: sequence-specific primers
  • ​Efficient, simple, and scalable: two-step quantitative RT-PCR assay provides high-quality results in less than three hours


Assay information
miRBase Accession Number
NR_004394.1
Chromosome Location
chr15:67839940-67840045
Mature miRNA Sequence:
GTGCTCGCTTCGGCAGCACATATACTAAAATT
GGAACGATACAGAGAAGATTAGCATGGCCC
CTGCGCAAGGATGACACGCAAATTCGTGAA
GCGTTCCATATTTTT
Species:
Human, Mouse
Assay System:
Probe-base qPCR assay
 


Design of TOOLS miRNA RT-qPCR assay system
TOOLS miRNA RT Kit
Cat#TTH-mi50 / TTH-mi250

TOOLS miRNA RT Kit provides the perfect first step of TOOLS miRNA RT-qPCR assay. This Kit adopts an innovative RT enzyme and buffer system, which enables the RT reaction completed within only 15 mins, and provides reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template.
  • Easy: Compatible with TOOLS miRNA RTqPCR primer/probe set, only common RT procedure required. 
  • Fast:  RT reaction completed only within 15 mins.
  • Accurate: Combination of an efficient reverse transcriptase and RNase inhibitor
  • Efficient: Reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template

TOOLS Easy 2xProbe qPCR Mix
Cat#TTC-QE13

This optimized ready-to-load mix contains dNTP/dUTP mix, Mg2+, modified hot-start DNA polymerase, dUTP/UDG anticontamination system, specific ROX Reference Dye, and all components necessary to be directly used for a robust and low-template qPCR with high sensitivity, specificity, and reliability. The dUTP/UDG anticontamination system included into the mix eliminates the product contamination of qPCR reactions.  TOOLS Easy 2×Probe qPCR Mix also contains ROX Reference Dye suitable for all qPCR instruments, and no adjustments are required for the dye concentration in different instruments.
  • Easy: All-in-one optimized master mix
  • Specific: Premixed with dUTP/UDG anticontamination system
  • High efficiency and stability
  • ROX Reference Dye for fluorescent signal normalization and compatible with all qPCR instruments.

EasyPrep miRNA Extraction Kit
Cat#DPT-BE01

EasyPrep miRNA Extraction Kit utilizes a silica-based system to enrich and purify small RNA, including miRNA, small interfering RNA (siRNA), small nuclear RNA (snRNA), and total RNA from various sample sources (cell, animal tissue, plant tissue, serum, plasma), especially for small RNA of <200 nt. The lysis buffer in the kit is optimized to exert excellent lysis ability and isolation efficiency. High-quality isolated product without contamination of DNA and protein could be obtained within 1 hour, and directly used in Northern Blot, Dot Blot, Poly A screening, in vitro translation, RNase protection analysis, and also molecular cloning.
  • Efficient: Completed within 1 hr
  • Quality: silica-based system to yield high-purity small RNA product
  • Flexible: Excellent lysis ability for various sample sources

Q1.  There are six sequences as controls for human miRNA assay, and what are the differences and significance among them? How to apply the control within miRNA profiling? 

A:cel-miR-39-3p, cel-miR-238-3p and cel-miR-54-3p are miRNA from Caenorhabditis elegans and would be used as exogenous control [1] or spike-in control. SNORD44, SNORD48, and RNU6B are endogenous controls when profiling human miRNA, and would be used as housekeeping genes [2]

The client could choose SNORD44, SNORD48, and RNU6B as endogenous controls according to the sample types or experiment design. If there is no suitable design of endogenous control, using exogenous control is also applied. When using exogenous control, the  corresponding spike-in RNA should be added into RNA samples before assay. Customized control is the other option and available from TOOLS. 

 

Q2.  In mRNA profiling, the cDNA samples used in qPCR are synthesized simultaneously, and GAPDH is used as the endogenous control for quantification. However, the stem-loop primer RT method of TOOLS is to synthesize the cDNA of each target separately. Does it make sense to use endogenous control for quantification?

A:Since miRNA sequence is much shorter compared to mRNA, and in order to improve the sensitivity and specificity of each miRNA target, the stem-loop RT method is considered a very efficient and excellent method for miRNA quantification. Indeed, each miRNA target including control is separately assayed, but the quantification based on all reactions using the same RNA sample under very same experiment conditions. 

 

Q3. Is there designed and validated control for Mouse and Rat??

A:Not yet. More search and corresponding materials published are needed, and if there is any, the client could order customized synthesis by us.

 
 

Reference

  1. Vigneron, N., et al., Towards a new standardized method for circulating miRNAs profiling in clinical studies: Interest of the exogenous normalization to improve miRNA signature accuracy. 2016. 10(7): p. 981-992.
  2. Donati, S., S. Ciuffi, and M.L.J.I.j.o.m.s. Brandi, Human circulating miRNAs real-time qRT-PCR-based analysis: an overview of endogenous reference genes used for data normalization. 2019. 20(18): p. 4353.