hsa-miR-429
TOOL miRNA RT-qPCR primer/probe set is an integral part of TOOL miRNA RT-qPCR assay which is based on two-step RT-qPCR to especially target microRNAs. Each TOOLS miRNA RT-qPCR primer/probe set is packaged including two parts: one tube containing the unique designed stem-loop RT primer and the other containing a mix of the qPCR probe, forward, and reverse primers.
Features
Assay information
-
Comprehensive: quantitate only mature miRNAs, not precursors
- Sensitive: sequence-specific primers
- Efficient, simple, and scalable: two-step quantitative RT-PCR assay provides high-quality results in less than three hours
Assay information
miRBase Accession Number
|
MIMAT0001536
|
Chromosome Location
|
chr1:1169055-1169076 (+)
|
Mature miRNA Sequence:
|
UAAUACUGUCUGGUAAAACCGU
|
Species:
|
Human
|
Assay System:
|
Probe-base qPCR assay
|
Design of TOOLS miRNA RT-qPCR assay system
Product name | miRNA ACC |
---|---|
hsa-let-7a-5p | MIMAT0000099 |
hsa-let-7b-5p | MIMAT0000063 |
hsa-let-7c-5p | MIMAT0000064 |
hsa-let-7d-3p | MIMAT0000433 |
hsa-let-7d-5p | MIMAT0000065 |
hsa-let-7f-5p | MIMAT0000067 |
hsa-let-7g-5p | MIMAT0000414 |
hsa-let-7i-3p | MIMAT0004585 |
hsa-miR-1-3p | MIMAT0000416 |
hsa-miR-9-5p | MIMAT0000441 |
hsa-miR-9-3p | MIMAT0000442 |
hsa-miR-10a-3p | MIMAT0004555 |
hsa-miR-10a-5p | MIMAT0000253 |
hsa-miR-10b-3p | MIMAT0004556 |
hsa-miR-10b-5p | MIMAT0000254 |
hsa-miR-15b-3p | MIMAT0004586 |
hsa-miR-15a-5p | MIMAT0000068 |
hsa-miR-15b-5p | MIMAT0000417 |
hsa-miR-16-5p | MIMAT0000069 |
hsa-miR-17-3p | MIMAT0000071 |
hsa-miR-17-5p | MIMAT0000070 |
hsa-miR-18a-5p | MIMAT0000072 |
hsa-miR-18b-5p | MIMAT0001412 |
hsa-miR-19a-3p | MIMAT0000073 |
hsa-miR-19b-3p | MIMAT0000074 |
hsa-miR-20a-5p | MIMAT0000075 |
hsa-miR-21-5p | MIMAT0000076 |
hsa-miR-22-3p | MIMAT0000077 |
hsa-miR-22-5p | MIMAT0004495 |
hsa-miR-23a-3p | MIMAT0000078 |
hsa-miR-23c | MIMAT0018000 |
hsa-miR-24-1-5p | MIMAT0000079 |
hsa-miR-24-3p | MIMAT0000080 |
hsa-miR-25-3p | MIMAT0000081 |
hsa-miR-25-5p | MIMAT0004498 |
hsa-miR-26a-5p | MIMAT0000082 |
hsa-miR-26b-5p | MIMAT0000083 |
hsa-miR-26a-1-3p | MIMAT0004499 |
hsa-miR-26a-2-3p | MIMAT0004681 |
hsa-miR-27a-3p | MIMAT0000084 |
hsa-miR-27b-3p | MIMAT0000419 |
hsa-miR-29a-3p | MIMAT0000086 |
hsa-miR-29a-5p | MIMAT0004503 |
hsa-miR-29b-2-5p | MIMAT0004515 |
hsa-miR-29b-3p | MIMAT0000100 |
hsa-miR-30a-3p | MIMAT0000088 |
hsa-miR-30a-5p | MIMAT0000087 |
hsa-miR-30b-5p | MIMAT0000420 |
hsa-miR-30c-5p | MIMAT0000244 |
hsa-miR-30d-5p | MIMAT0000245 |
hsa-miR-30e-5p | MIMAT0000692 |
hsa-miR-30e-3p | MIMAT0000693 |
hsa-miR-31-5p | MIMAT0000089 |
hsa-miR-32-5p | MIMAT0000090 |
hsa-miR-33a-5p | MIMAT0000091 |
hsa-miR-34a-5p | MIMAT0000255 |
hsa-miR-34c-5p | MIMAT0000686 |
hsa-miR-92a-3p | MIMAT0000092 |
hsa-miR-92b-3p | MIMAT0003218 |
hsa-miR-93-5p | MIMAT0000093 |
hsa-miR-98-5p | MIMAT0000096 |
hsa-miR-99a-5p | MIMAT0000097 |
hsa-miR-99b-5p | MIMAT0000689 |
hsa-miR-100-5p | MIMAT0000098 |
hsa-miR-101-3p | MIMAT0000099 |
hsa-miR-101-5p | MIMAT0004513 |
hsa-miR-103a-3p | MIMAT0000101 |
hsa-miR-106a-5p | MIMAT0000103 |
hsa-miR-106b-3p | MIMAT0004672 |
hsa-miR-106b-5p | MIMAT0000680 |
hsa-miR-107 | MIMAT0000104 |
hsa-miR-122-5p | MIMAT0000421 |
hsa-miR-125a-5p | MIMAT0000443 |
hsa-miR-125b-5p | MIMAT0000423 |
hsa-miR-126-5p | MIMAT0000444 |
hsa-miR-126-3p | MIMAT0000445 |
hsa-miR-127-3p | MIMAT0000446 |
hsa-miR-128-3p | MIMAT0000424 |
hsa-miR-130b-3p | MIMAT0000691 |
hsa-miR-130b-5p | MIMAT0004680 |
hsa-miR-132-3p | MIMAT0000426 |
hsa-miR-133a-3p | MIMAT0000427 |
hsa-mir-133a-5p | MIMAT0026478 |
hsa-miR-133b | MIMAT0000770 |
hsa-miR-135b-5p | MIMAT0000758 |
hsa-miR-135a-3p | MIMAT0004595 |
hsa-miR-135a-5p | MIMAT0000428 |
Product name | miRNA ACC |
---|---|
hsa-miR-139-3p | MIMAT0004552 |
hsa-miR-140-3p | MIMAT0004597 |
hsa-miR-141-3p | MIMAT0000432 |
hsa-miR-142-5p | MIMAT0000433 |
hsa-miR-142-3p | MIMAT0000434 |
hsa-miR-143-3p | MIMAT0000435 |
hsa-miR-144-3p | MIMAT0000436 |
hsa-miR-144-3p | MIMAT0004600 |
hsa-miR-145-5p | MIMAT0000437 |
hsa-miR-146a-5p | MIMAT0000449 |
hsa-miR-148a-3p | MIMAT0000243 |
hsa-miR-148a-5p | MIMAT0004549 |
hsa-miR-148b-3p | MIMAT0000759 |
hsa-miR-149-5p | MIMAT0000450 |
hsa-miR-150-5p | MIMAT0000451 |
hsa-miR-151a-3p | MIMAT0000757 |
hsa-miR-181a-3p | MIMAT0000270 |
hsa-miR-181a-5p | MIMAT0000256 |
hsa-miR-181b-5p | MIMAT0000257 |
hsa-miR-182-5p | MIMAT0000259 |
hsa-miR-183-5p | MIMAT0000261 |
hsa-miR-184 | MIMAT0000454 |
hsa-miR-185-5p | MIMAT0000455 |
hsa-miR-186-5p | MIMAT0000456 |
hsa-miR-187-3p | MIMAT0000262 |
hsa-miR-191-5p | MIMAT0000440 |
hsa-miR-192-5p | MIMAT0000222 |
hsa-miR-193a-5p | MIMAT0004614 |
hsa-miR-193b-3p | MIMAT0002819 |
hsa-miR-193b-5p | MIMAT0004767 |
hsa-miR-194-5p | MIMAT0000460 |
hsa-miR-195-5p | MIMAT0000461 |
hsa-miR-196a-5p | MIMAT0000226 |
hsa-miR-196b-5p | MIMAT0001080 |
hsa-miR-197-3p | MIMAT0000227 |
hsa-miR-199a-3p | MIMAT0000232 |
hsa-miR-199b-5p | MIMAT0000263 |
hsa-miR-200a-3p | MIMAT0000682 |
hsa-miR-200c-3p | MIMAT0000617 |
hsa-miR-203a-3p | MIMAT0000264 |
hsa-mir-204-3p | MIMAT0022693 |
hsa-miR-204-5p | MIMAT0000265 |
hsa-miR-205-5p | MIMAT0000266 |
hsa-miR-208a-3p | MIMAT0000241 |
hsa-miR-208b-3p | MIMAT0004960 |
hsa-miR-210-3p | MIMAT0000267 |
hsa-miR-211-5p | MIMAT0000268 |
hsa-miR-212-3p | MIMAT0000269 |
hsa-miR-214-3p | MIMAT0000271 |
hsa-miR-215-5p | MIMAT0000272 |
hsa-miR-218-5p | MIMAT0000275 |
hsa-miR-221-3p | MIMAT0000278 |
hsa-miR-222-3p | MIMAT0000279 |
hsa-miR-223-3p | MIMAT0000280 |
hsa-miR-223-5p | MIMAT0004570 |
hsa-miR-224-5p | MIMAT0000281 |
hsa-miR-296-3p | MIMAT0004679 |
hsa-miR-320a-3p | MIMAT0000510 |
hsa-miR-320d | MIMAT0006764 |
hsa-miR-324-3p | MIMAT0000762 |
hsa-miR-328-3p | MIMAT0000752 |
hsa-miR-330-3p | MIMAT0000751 |
hsa-miR-335-3p | MIMAT0004703 |
hsa-miR-335-5p | MIMAT0000765 |
hsa-miR-338-3p | MIMAT0000763 |
hsa-miR-339-3p | MIMAT0004702 |
hsa-miR-340-5p | MIMAT0004692 |
hsa-miR-342-3p | MIMAT0000753 |
hsa-miR-342-5p | MIMAT0004694 |
hsa-miR-365a-3p | MIMAT0000710 |
hsa-miR-365a-5p | MIMAT0009199 |
hsa-miR-367-3p | MIMAT0000719 |
hsa-miR-374b-5p | MIMAT0004955 |
hsa-miR-375-3p | MIMAT0000728 |
hsa-miR-378a-3p | MIMAT0000732 |
hsa-miR-378a-5p | MIMAT0000731 |
hsa-mir-409-3p | MIMAT0001639 |
hsa-miR-421 | MIMAT0003339 |
hsa-miR-423-3p | MIMAT0001340 |
hsa-miR-423-5p | MIMAT0004748 |
hhsa-miR-425-5p | MIMAT0003393 |
hsa-miR-429 | MIMAT0001536 |
hsa-miR-450a-5p | MIMAT0001545 |
hsa-miR-451a | MIMAT0001631 |
hsa-miR-452-5p | MIMAT0001635 |
hsa-miR-455-3p | MIMAT0004784 |
hsa-miR-455-5p | MIMAT0003150 |
Product name | miRNA ACC |
---|---|
hsa-miR-486-3p | MIMAT0004762 |
hsa-miR-489-3p | MIMAT0002805 |
hsa-miR-494-3p | MIMAT0002816 |
hsa-miR-497-5p | MIMAT0002820 |
hsa-miR-499a-5p | MIMAT0002870 |
hsa-miR-500a-3p | MIMAT0002871 |
hsa-miR-501-3p | MIMAT0004774 |
hsa-miR-502-3p | MIMAT0004775 |
hsa-miR-506-3p | MIMAT0002878 |
hsa-miR-508-3p | MIMAT0002880 |
hsa-miR-509-5p | MIMAT0004779 |
hsa-miR-514a-3p | MIMAT0002883 |
hsa-miR-532-5p | MIMAT0002888 |
hsa-miR-548f-5p | MIMAT0026739 |
hsa-miR-548h-5p | MIMAT0005928 |
hsa-miR-548ar-5p | MIMAT0022265 |
hsa-miR-548aj-5p | MIMAT0022739 |
hsa-miR-550a-5p | MIMAT0004800 |
hsa-miR-574-3p | MIMAT0003239 |
hsa-miR-576-5p | MIMAT0003241 |
hsa-miR-582-3p | MIMAT0004797 |
hsa-miR-584-5p | MIMAT0003249 |
hsa-miR-615-3p | MIMAT0003283 |
hsa-miR-619-3p | MIMAT0003288 |
hsa-miR-624-3p | MIMAT0004807 |
hsa-miR-625-3p | MIMAT0004808 |
hsa-miR-625-5p | MIMAT0003294 |
hsa-miR-627-5p | MIMAT0003296 |
hsa-miR-629-5p | MIMAT0004810 |
hsa-miR-633 | MIMAT0003303 |
hsa-miR-640 | MIMAT0003310 |
hsa-miR-644a | MIMAT0003314 |
hsa-miR-663a | MIMAT0003326 |
hsa-miR-664a-3p | MIMAT0005949 |
hsa-miR-664a-5p | MIMAT0005948 |
hsa-miR-671-5p | MIMAT0003880 |
hsa-miR-744-5p | MIMAT0004945 |
hsa-miR-765 | MIMAT0003945 |
hsa-miR-877-5p | MIMAT0004949 |
hsa-miR-888-5p | MIMAT0004916 |
hsa-miR-933 | MIMAT0004976 |
hsa-miR-937-3p | MIMAT0004980 |
hsa-miR-941 | MIMAT0004984 |
hsa-miR-1180-3p | MIMAT0005825 |
hsa-miR-1207-5p | MIMAT0005871 |
hsa-miR-1226-3p | MIMAT0005577 |
hsa-miR-1227-3p | MIMAT0005580 |
hsa-miR-1229-3p | MIMAT0005580 |
hsa-miR-1238-3p | MIMAT0005593 |
hsa-miR-1246 | MIMAT0005898 |
hsa-miR-1247-5p | MIMAT0005899 |
hsa-miR-1276 | MIMAT0005930 |
hsa-miR-1285-3p | MIMAT0005876 |
hsa-miR-1291 | MIMAT0005881 |
hsa-miR-1292-5p | MIMAT0005943 |
hsa-miR-1307-5p | MIMAT0022727 |
hsa-miR-1322 | MIMAT0005953 |
hsa-miR-1909-3p | MIMAT0007883 |
hsa-miR-2110 | MIMAT0010133 |
hsa-miR-3150a-5p | MIMAT0019206 |
hsa-miR-3158-3p | MIMAT0015032 |
hsa-miR-3166 | MIMAT0015040 |
hsa-miR-3198 | MIMAT0015083 |
hsa-miR-3615 | MIMAT0017994 |
hsa-miR-3688-3p | MIMAT0018116 |
hsa-miR-4260 | MIMAT0016881 |
hsa-miR-4301 | MIMAT0016850 |
hsa-miR-4304 | MIMAT0016854 |
hsa-miR-4436b-5p | MIMAT0019940 |
hsa-miR-4454 | MIMAT0018976 |
hsa-miR-4479 | MIMAT0019011 |
hsa-miR-4488 | MIMAT0019022 |
hsa-miR-4732-3p | MIMAT0019856 |
hsa-miR-4755-3p | MIMAT0019896 |
hsa-miR-4772-5p | MIMAT0019926 |
hsa-miR-4793-3p | MIMAT0019966 |
hsa-miR-5684 | MIMAT0022473 |
hsa-miR-5693 | MIMAT0022486 |
hsa-miR-7706 | MIMAT0030021 |
hsa-miR-7974 | MIMAT0031177 |
hsa-miR-12136 | MIMAT0049032 |
cel-miR-238-3p | MIMAT0000293 |
SNORD48 | NR_002745.1 |
SNORD44 | NR_002750.2 |
RNU6B | NR_004394.1 |
cel-miR-39-3p | MIMAT0000010 |
cel-miR-54-3p | MIMAT0000025 |
TOOLS miRNA RT Kit
Cat#TTH-mi50 / TTH-mi250
TOOLS miRNA RT Kit provides the perfect first step of TOOLS miRNA RT-qPCR assay. This Kit adopts an innovative RT enzyme and buffer system, which enables the RT reaction completed within only 15 mins, and provides reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template.
Cat#TTH-mi50 / TTH-mi250
TOOLS miRNA RT Kit provides the perfect first step of TOOLS miRNA RT-qPCR assay. This Kit adopts an innovative RT enzyme and buffer system, which enables the RT reaction completed within only 15 mins, and provides reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template.
-
Easy: Compatible with TOOLS miRNA RTqPCR primer/probe set, only common RT procedure required.
-
Fast: RT reaction completed only within 15 mins.
-
Accurate: Combination of an efficient reverse transcriptase and RNase inhibitor
-
Efficient: Reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template
TOOLS Easy 2xProbe qPCR Mix
Cat#TTC-QE13
This optimized ready-to-load mix contains dNTP/dUTP mix, Mg2+, modified hot-start DNA polymerase, dUTP/UDG anticontamination system, specific ROX Reference Dye, and all components necessary to be directly used for a robust and low-template qPCR with high sensitivity, specificity, and reliability. The dUTP/UDG anticontamination system included into the mix eliminates the product contamination of qPCR reactions. TOOLS Easy 2×Probe qPCR Mix also contains ROX Reference Dye suitable for all qPCR instruments, and no adjustments are required for the dye concentration in different instruments.
Cat#TTC-QE13
This optimized ready-to-load mix contains dNTP/dUTP mix, Mg2+, modified hot-start DNA polymerase, dUTP/UDG anticontamination system, specific ROX Reference Dye, and all components necessary to be directly used for a robust and low-template qPCR with high sensitivity, specificity, and reliability. The dUTP/UDG anticontamination system included into the mix eliminates the product contamination of qPCR reactions. TOOLS Easy 2×Probe qPCR Mix also contains ROX Reference Dye suitable for all qPCR instruments, and no adjustments are required for the dye concentration in different instruments.
-
Easy: All-in-one optimized master mix
-
Specific: Premixed with dUTP/UDG anticontamination system
-
High efficiency and stability
-
ROX Reference Dye for fluorescent signal normalization and compatible with all qPCR instruments.
EasyPrep miRNA Extraction Kit
Cat#DPT-BE01
EasyPrep miRNA Extraction Kit utilizes a silica-based system to enrich and purify small RNA, including miRNA, small interfering RNA (siRNA), small nuclear RNA (snRNA), and total RNA from various sample sources (cell, animal tissue, plant tissue, serum, plasma), especially for small RNA of <200 nt. The lysis buffer in the kit is optimized to exert excellent lysis ability and isolation efficiency. High-quality isolated product without contamination of DNA and protein could be obtained within 1 hour, and directly used in Northern Blot, Dot Blot, Poly A screening, in vitro translation, RNase protection analysis, and also molecular cloning.
- Efficient: Completed within 1 hr
- Quality: silica-based system to yield high-purity small RNA product
- Flexible: Excellent lysis ability for various sample sources
Breast Cancer
- Ye, Zhi-Bin, et al. "miR-429 inhibits migration and invasion of breast cancer cells in vitro." International journal of oncology 46.2 (2015): 531-538.
- Cava, Claudia, et al. "Theranostic application of miR-429 in HER2+ breast cancer." Theranostics 10.1 (2020): 50.
- Dai, Wenzhu, et al. "miR-148b-3p, miR-190b, and miR-429 regulate cell progression and act as potential biomarkers for breast cancer." Journal of breast cancer 22.2 (2019): 219.
- Wang, Chen, et al. "miR-429 mediates δ-tocotrienol-induced apoptosis in triple-negative breast cancer cells by targeting XIAP." International journal of clinical and experimental medicine 8.9 (2015): 15648.
- Zhang, Xinxin, et al. "MicroRNA-429 inhibits bone metastasis in breast cancer by regulating CrkL and MMP-9." Bone 130 (2020): 115139.
Colorectal Cancer
- Skok, Daša Jevšinek, et al. "The integrative knowledge base for miRNA-mRNA expression in colorectal cancer." Scientific reports 9.1 (2019): 1-9.
- Liu, Hong, et al. "Effect of evodiamine and berberine on miR-429 as an oncogene in human colorectal cancer." OncoTargets and therapy 9 (2016): 4121.
- Chen, Xia, et al. "MiR-429 Involves in the Pathogenesis of Colorectal Cancer via Directly Targeting LATS2." Oxidative Medicine and Cellular Longevity 2020 (2020).
- Tian, Xiangyang, et al. "MicroRNA-429 inhibits the migration and invasion of colon cancer cells by targeting PAK6/cofilin signaling." Oncology reports 34.2 (2015): 707-714.
- Dong, Sheng-jian, Xiao-jun Cai, and Shu-jin Li. "The clinical significance of MiR-429 as a predictive biomarker in colorectal cancer patients receiving 5-fluorouracil treatment." Medical science monitor: international medical journal of experimental and clinical research 22 (2016): 3352.
- Cheng, Guohua, et al. "The microRNA-429/DUSP4 axis regulates the sensitivity of colorectal cancer cells to nintedanib." Molecular Medicine Reports 23.4 (2021): 1-1.
Parkinson Disease
- Martinez, Bridget, and Philip V. Peplow. "MicroRNAs in Parkinson's disease and emerging therapeutic targets." Neural Regeneration Research 12.12 (2017): 1945.
- Singh, Abhishek, and Dwaipayan Sen. "MicroRNAs in Parkinson’s disease." Experimental brain research 235.8 (2017): 2359-2374.