hsa-mir-409-3p
TOOL miRNA RT-qPCR primer/probe set is an integral part of TOOL miRNA RT-qPCR assay which is based on two-step RT-qPCR to especially target microRNAs. Each TOOLS miRNA RT-qPCR primer/probe set is packaged including two parts: one tube containing the unique designed stem-loop RT primer and the other containing a mix of the qPCR probe, forward, and reverse primers.
Features
Assay information
-
Comprehensive: quantitate only mature miRNAs, not precursors
- Sensitive: sequence-specific primers
- Efficient, simple, and scalable: two-step quantitative RT-PCR assay provides high-quality results in less than three hours
Assay information
|
miRBase Accession Number
|
MIMAT0001639
|
|
Chromosome Location
|
chr14:101065346-101065367 (+)
chr20:63919914-63919936 (+) |
|
Mature miRNA Sequence:
|
GAAUGUUGCUCGGUGAACCCCU
|
|
Species:
|
Human
|
|
Assay System:
|
Probe-base qPCR assay
|
Design of TOOLS miRNA RT-qPCR assay system
.jpg)
| Product name | miRNA ACC |
|---|---|
| hsa-let-7a-5p | MIMAT0000099 |
| hsa-let-7b-5p | MIMAT0000063 |
| hsa-let-7c-5p | MIMAT0000064 |
| hsa-let-7d-3p | MIMAT0000433 |
| hsa-let-7d-5p | MIMAT0000065 |
| hsa-let-7f-5p | MIMAT0000067 |
| hsa-let-7g-5p | MIMAT0000414 |
| hsa-let-7i-3p | MIMAT0004585 |
| hsa-miR-1-3p | MIMAT0000416 |
| hsa-miR-9-5p | MIMAT0000441 |
| hsa-miR-9-3p | MIMAT0000442 |
| hsa-miR-10a-3p | MIMAT0004555 |
| hsa-miR-10a-5p | MIMAT0000253 |
| hsa-miR-10b-3p | MIMAT0004556 |
| hsa-miR-10b-5p | MIMAT0000254 |
| hsa-miR-15b-3p | MIMAT0004586 |
| hsa-miR-15a-5p | MIMAT0000068 |
| hsa-miR-15b-5p | MIMAT0000417 |
| hsa-miR-16-5p | MIMAT0000069 |
| hsa-miR-17-3p | MIMAT0000071 |
| hsa-miR-17-5p | MIMAT0000070 |
| hsa-miR-18a-5p | MIMAT0000072 |
| hsa-miR-18b-5p | MIMAT0001412 |
| hsa-miR-19a-3p | MIMAT0000073 |
| hsa-miR-19b-3p | MIMAT0000074 |
| hsa-miR-20a-5p | MIMAT0000075 |
| hsa-miR-21-5p | MIMAT0000076 |
| hsa-miR-22-3p | MIMAT0000077 |
| hsa-miR-22-5p | MIMAT0004495 |
| hsa-miR-23a-3p | MIMAT0000078 |
| hsa-miR-23c | MIMAT0018000 |
| hsa-miR-24-1-5p | MIMAT0000079 |
| hsa-miR-24-3p | MIMAT0000080 |
| hsa-miR-25-3p | MIMAT0000081 |
| hsa-miR-25-5p | MIMAT0004498 |
| hsa-miR-26a-5p | MIMAT0000082 |
| hsa-miR-26b-5p | MIMAT0000083 |
| hsa-miR-26a-1-3p | MIMAT0004499 |
| hsa-miR-26a-2-3p | MIMAT0004681 |
| hsa-miR-27a-3p | MIMAT0000084 |
| hsa-miR-27b-3p | MIMAT0000419 |
| hsa-miR-29a-3p | MIMAT0000086 |
| hsa-miR-29a-5p | MIMAT0004503 |
| hsa-miR-29b-2-5p | MIMAT0004515 |
| hsa-miR-29b-3p | MIMAT0000100 |
| hsa-miR-30a-3p | MIMAT0000088 |
| hsa-miR-30a-5p | MIMAT0000087 |
| hsa-miR-30b-5p | MIMAT0000420 |
| hsa-miR-30c-5p | MIMAT0000244 |
| hsa-miR-30d-5p | MIMAT0000245 |
| hsa-miR-30e-5p | MIMAT0000692 |
| hsa-miR-30e-3p | MIMAT0000693 |
| hsa-miR-31-5p | MIMAT0000089 |
| hsa-miR-32-5p | MIMAT0000090 |
| hsa-miR-33a-5p | MIMAT0000091 |
| hsa-miR-34a-5p | MIMAT0000255 |
| hsa-miR-34c-5p | MIMAT0000686 |
| hsa-miR-92a-3p | MIMAT0000092 |
| hsa-miR-92b-3p | MIMAT0003218 |
| hsa-miR-93-5p | MIMAT0000093 |
| hsa-miR-98-5p | MIMAT0000096 |
| hsa-miR-99a-5p | MIMAT0000097 |
| hsa-miR-99b-5p | MIMAT0000689 |
| hsa-miR-100-5p | MIMAT0000098 |
| hsa-miR-101-3p | MIMAT0000099 |
| hsa-miR-101-5p | MIMAT0004513 |
| hsa-miR-103a-3p | MIMAT0000101 |
| hsa-miR-106a-5p | MIMAT0000103 |
| hsa-miR-106b-3p | MIMAT0004672 |
| hsa-miR-106b-5p | MIMAT0000680 |
| hsa-miR-107 | MIMAT0000104 |
| hsa-miR-122-5p | MIMAT0000421 |
| hsa-miR-125a-5p | MIMAT0000443 |
| hsa-miR-125b-5p | MIMAT0000423 |
| hsa-miR-126-5p | MIMAT0000444 |
| hsa-miR-126-3p | MIMAT0000445 |
| hsa-miR-127-3p | MIMAT0000446 |
| hsa-miR-128-3p | MIMAT0000424 |
| hsa-miR-130b-3p | MIMAT0000691 |
| hsa-miR-130b-5p | MIMAT0004680 |
| hsa-miR-132-3p | MIMAT0000426 |
| hsa-miR-133a-3p | MIMAT0000427 |
| hsa-mir-133a-5p | MIMAT0026478 |
| hsa-miR-133b | MIMAT0000770 |
| hsa-miR-135b-5p | MIMAT0000758 |
| hsa-miR-135a-3p | MIMAT0004595 |
| hsa-miR-135a-5p | MIMAT0000428 |
| Product name | miRNA ACC |
|---|---|
| hsa-miR-139-3p | MIMAT0004552 |
| hsa-miR-140-3p | MIMAT0004597 |
| hsa-miR-141-3p | MIMAT0000432 |
| hsa-miR-142-5p | MIMAT0000433 |
| hsa-miR-142-3p | MIMAT0000434 |
| hsa-miR-143-3p | MIMAT0000435 |
| hsa-miR-144-3p | MIMAT0000436 |
| hsa-miR-144-3p | MIMAT0004600 |
| hsa-miR-145-5p | MIMAT0000437 |
| hsa-miR-146a-5p | MIMAT0000449 |
| hsa-miR-148a-3p | MIMAT0000243 |
| hsa-miR-148a-5p | MIMAT0004549 |
| hsa-miR-148b-3p | MIMAT0000759 |
| hsa-miR-149-5p | MIMAT0000450 |
| hsa-miR-150-5p | MIMAT0000451 |
| hsa-miR-151a-3p | MIMAT0000757 |
| hsa-miR-181a-3p | MIMAT0000270 |
| hsa-miR-181a-5p | MIMAT0000256 |
| hsa-miR-181b-5p | MIMAT0000257 |
| hsa-miR-182-5p | MIMAT0000259 |
| hsa-miR-183-5p | MIMAT0000261 |
| hsa-miR-184 | MIMAT0000454 |
| hsa-miR-185-5p | MIMAT0000455 |
| hsa-miR-186-5p | MIMAT0000456 |
| hsa-miR-187-3p | MIMAT0000262 |
| hsa-miR-191-5p | MIMAT0000440 |
| hsa-miR-192-5p | MIMAT0000222 |
| hsa-miR-193a-5p | MIMAT0004614 |
| hsa-miR-193b-3p | MIMAT0002819 |
| hsa-miR-193b-5p | MIMAT0004767 |
| hsa-miR-194-5p | MIMAT0000460 |
| hsa-miR-195-5p | MIMAT0000461 |
| hsa-miR-196a-5p | MIMAT0000226 |
| hsa-miR-196b-5p | MIMAT0001080 |
| hsa-miR-197-3p | MIMAT0000227 |
| hsa-miR-199a-3p | MIMAT0000232 |
| hsa-miR-199b-5p | MIMAT0000263 |
| hsa-miR-200a-3p | MIMAT0000682 |
| hsa-miR-200c-3p | MIMAT0000617 |
| hsa-miR-203a-3p | MIMAT0000264 |
| hsa-mir-204-3p | MIMAT0022693 |
| hsa-miR-204-5p | MIMAT0000265 |
| hsa-miR-205-5p | MIMAT0000266 |
| hsa-miR-208a-3p | MIMAT0000241 |
| hsa-miR-208b-3p | MIMAT0004960 |
| hsa-miR-210-3p | MIMAT0000267 |
| hsa-miR-211-5p | MIMAT0000268 |
| hsa-miR-212-3p | MIMAT0000269 |
| hsa-miR-214-3p | MIMAT0000271 |
| hsa-miR-215-5p | MIMAT0000272 |
| hsa-miR-218-5p | MIMAT0000275 |
| hsa-miR-221-3p | MIMAT0000278 |
| hsa-miR-222-3p | MIMAT0000279 |
| hsa-miR-223-3p | MIMAT0000280 |
| hsa-miR-223-5p | MIMAT0004570 |
| hsa-miR-224-5p | MIMAT0000281 |
| hsa-miR-296-3p | MIMAT0004679 |
| hsa-miR-320a-3p | MIMAT0000510 |
| hsa-miR-320d | MIMAT0006764 |
| hsa-miR-324-3p | MIMAT0000762 |
| hsa-miR-328-3p | MIMAT0000752 |
| hsa-miR-330-3p | MIMAT0000751 |
| hsa-miR-335-3p | MIMAT0004703 |
| hsa-miR-335-5p | MIMAT0000765 |
| hsa-miR-338-3p | MIMAT0000763 |
| hsa-miR-339-3p | MIMAT0004702 |
| hsa-miR-340-5p | MIMAT0004692 |
| hsa-miR-342-3p | MIMAT0000753 |
| hsa-miR-342-5p | MIMAT0004694 |
| hsa-miR-365a-3p | MIMAT0000710 |
| hsa-miR-365a-5p | MIMAT0009199 |
| hsa-miR-367-3p | MIMAT0000719 |
| hsa-miR-374b-5p | MIMAT0004955 |
| hsa-miR-375-3p | MIMAT0000728 |
| hsa-miR-378a-3p | MIMAT0000732 |
| hsa-miR-378a-5p | MIMAT0000731 |
| hsa-mir-409-3p | MIMAT0001639 |
| hsa-miR-421 | MIMAT0003339 |
| hsa-miR-423-3p | MIMAT0001340 |
| hsa-miR-423-5p | MIMAT0004748 |
| hhsa-miR-425-5p | MIMAT0003393 |
| hsa-miR-429 | MIMAT0001536 |
| hsa-miR-450a-5p | MIMAT0001545 |
| hsa-miR-451a | MIMAT0001631 |
| hsa-miR-452-5p | MIMAT0001635 |
| hsa-miR-455-3p | MIMAT0004784 |
| hsa-miR-455-5p | MIMAT0003150 |
| Product name | miRNA ACC |
|---|---|
| hsa-miR-486-3p | MIMAT0004762 |
| hsa-miR-489-3p | MIMAT0002805 |
| hsa-miR-494-3p | MIMAT0002816 |
| hsa-miR-497-5p | MIMAT0002820 |
| hsa-miR-499a-5p | MIMAT0002870 |
| hsa-miR-500a-3p | MIMAT0002871 |
| hsa-miR-501-3p | MIMAT0004774 |
| hsa-miR-502-3p | MIMAT0004775 |
| hsa-miR-506-3p | MIMAT0002878 |
| hsa-miR-508-3p | MIMAT0002880 |
| hsa-miR-509-5p | MIMAT0004779 |
| hsa-miR-514a-3p | MIMAT0002883 |
| hsa-miR-532-5p | MIMAT0002888 |
| hsa-miR-548f-5p | MIMAT0026739 |
| hsa-miR-548h-5p | MIMAT0005928 |
| hsa-miR-548ar-5p | MIMAT0022265 |
| hsa-miR-548aj-5p | MIMAT0022739 |
| hsa-miR-550a-5p | MIMAT0004800 |
| hsa-miR-574-3p | MIMAT0003239 |
| hsa-miR-576-5p | MIMAT0003241 |
| hsa-miR-582-3p | MIMAT0004797 |
| hsa-miR-584-5p | MIMAT0003249 |
| hsa-miR-615-3p | MIMAT0003283 |
| hsa-miR-619-3p | MIMAT0003288 |
| hsa-miR-624-3p | MIMAT0004807 |
| hsa-miR-625-3p | MIMAT0004808 |
| hsa-miR-625-5p | MIMAT0003294 |
| hsa-miR-627-5p | MIMAT0003296 |
| hsa-miR-629-5p | MIMAT0004810 |
| hsa-miR-633 | MIMAT0003303 |
| hsa-miR-640 | MIMAT0003310 |
| hsa-miR-644a | MIMAT0003314 |
| hsa-miR-663a | MIMAT0003326 |
| hsa-miR-664a-3p | MIMAT0005949 |
| hsa-miR-664a-5p | MIMAT0005948 |
| hsa-miR-671-5p | MIMAT0003880 |
| hsa-miR-744-5p | MIMAT0004945 |
| hsa-miR-765 | MIMAT0003945 |
| hsa-miR-877-5p | MIMAT0004949 |
| hsa-miR-888-5p | MIMAT0004916 |
| hsa-miR-933 | MIMAT0004976 |
| hsa-miR-937-3p | MIMAT0004980 |
| hsa-miR-941 | MIMAT0004984 |
| hsa-miR-1180-3p | MIMAT0005825 |
| hsa-miR-1207-5p | MIMAT0005871 |
| hsa-miR-1226-3p | MIMAT0005577 |
| hsa-miR-1227-3p | MIMAT0005580 |
| hsa-miR-1229-3p | MIMAT0005580 |
| hsa-miR-1238-3p | MIMAT0005593 |
| hsa-miR-1246 | MIMAT0005898 |
| hsa-miR-1247-5p | MIMAT0005899 |
| hsa-miR-1276 | MIMAT0005930 |
| hsa-miR-1285-3p | MIMAT0005876 |
| hsa-miR-1291 | MIMAT0005881 |
| hsa-miR-1292-5p | MIMAT0005943 |
| hsa-miR-1307-5p | MIMAT0022727 |
| hsa-miR-1322 | MIMAT0005953 |
| hsa-miR-1909-3p | MIMAT0007883 |
| hsa-miR-2110 | MIMAT0010133 |
| hsa-miR-3150a-5p | MIMAT0019206 |
| hsa-miR-3158-3p | MIMAT0015032 |
| hsa-miR-3166 | MIMAT0015040 |
| hsa-miR-3198 | MIMAT0015083 |
| hsa-miR-3615 | MIMAT0017994 |
| hsa-miR-3688-3p | MIMAT0018116 |
| hsa-miR-4260 | MIMAT0016881 |
| hsa-miR-4301 | MIMAT0016850 |
| hsa-miR-4304 | MIMAT0016854 |
| hsa-miR-4436b-5p | MIMAT0019940 |
| hsa-miR-4454 | MIMAT0018976 |
| hsa-miR-4479 | MIMAT0019011 |
| hsa-miR-4488 | MIMAT0019022 |
| hsa-miR-4732-3p | MIMAT0019856 |
| hsa-miR-4755-3p | MIMAT0019896 |
| hsa-miR-4772-5p | MIMAT0019926 |
| hsa-miR-4793-3p | MIMAT0019966 |
| hsa-miR-5684 | MIMAT0022473 |
| hsa-miR-5693 | MIMAT0022486 |
| hsa-miR-7706 | MIMAT0030021 |
| hsa-miR-7974 | MIMAT0031177 |
| hsa-miR-12136 | MIMAT0049032 |
| cel-miR-238-3p | MIMAT0000293 |
| SNORD48 | NR_002745.1 |
| SNORD44 | NR_002750.2 |
| RNU6B | NR_004394.1 |
| cel-miR-39-3p | MIMAT0000010 |
| cel-miR-54-3p | MIMAT0000025 |
TOOLS miRNA RT Kit
Cat#TTH-mi50 / TTH-mi250
TOOLS miRNA RT Kit provides the perfect first step of TOOLS miRNA RT-qPCR assay. This Kit adopts an innovative RT enzyme and buffer system, which enables the RT reaction completed within only 15 mins, and provides reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template.
Cat#TTH-mi50 / TTH-mi250
TOOLS miRNA RT Kit provides the perfect first step of TOOLS miRNA RT-qPCR assay. This Kit adopts an innovative RT enzyme and buffer system, which enables the RT reaction completed within only 15 mins, and provides reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template.
-
Easy: Compatible with TOOLS miRNA RTqPCR primer/probe set, only common RT procedure required.
-
Fast: RT reaction completed only within 15 mins.
-
Accurate: Combination of an efficient reverse transcriptase and RNase inhibitor
-
Efficient: Reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template
TOOLS Easy 2xProbe qPCR Mix
Cat#TTC-QE13
This optimized ready-to-load mix contains dNTP/dUTP mix, Mg2+, modified hot-start DNA polymerase, dUTP/UDG anticontamination system, specific ROX Reference Dye, and all components necessary to be directly used for a robust and low-template qPCR with high sensitivity, specificity, and reliability. The dUTP/UDG anticontamination system included into the mix eliminates the product contamination of qPCR reactions. TOOLS Easy 2×Probe qPCR Mix also contains ROX Reference Dye suitable for all qPCR instruments, and no adjustments are required for the dye concentration in different instruments.
Cat#TTC-QE13
This optimized ready-to-load mix contains dNTP/dUTP mix, Mg2+, modified hot-start DNA polymerase, dUTP/UDG anticontamination system, specific ROX Reference Dye, and all components necessary to be directly used for a robust and low-template qPCR with high sensitivity, specificity, and reliability. The dUTP/UDG anticontamination system included into the mix eliminates the product contamination of qPCR reactions. TOOLS Easy 2×Probe qPCR Mix also contains ROX Reference Dye suitable for all qPCR instruments, and no adjustments are required for the dye concentration in different instruments.
-
Easy: All-in-one optimized master mix
-
Specific: Premixed with dUTP/UDG anticontamination system
-
High efficiency and stability
-
ROX Reference Dye for fluorescent signal normalization and compatible with all qPCR instruments.
EasyPrep miRNA Extraction Kit
Cat#DPT-BE01
EasyPrep miRNA Extraction Kit utilizes a silica-based system to enrich and purify small RNA, including miRNA, small interfering RNA (siRNA), small nuclear RNA (snRNA), and total RNA from various sample sources (cell, animal tissue, plant tissue, serum, plasma), especially for small RNA of <200 nt. The lysis buffer in the kit is optimized to exert excellent lysis ability and isolation efficiency. High-quality isolated product without contamination of DNA and protein could be obtained within 1 hour, and directly used in Northern Blot, Dot Blot, Poly A screening, in vitro translation, RNase protection analysis, and also molecular cloning.
- Efficient: Completed within 1 hr
- Quality: silica-based system to yield high-purity small RNA product
- Flexible: Excellent lysis ability for various sample sources
Breast Cancer
- Ma, Zhenhai, et al. "MicroRNA‐409‐3p regulates cell invasion and metastasis by targeting ZEB1 in breast cancer." IUBMB life 68.5 (2016): 394-402.
- Cuk, Katarina, et al. "Plasma microRNA panel for minimally invasive detection of breast cancer." PloS one 8.10 (2013): e76729.
- Zhang, Guoqiang, et al. "miR-409-3p suppresses breast cancer cell growth and invasion by targeting Akt1." Biochemical and biophysical research communications 469.2 (2016): 189-195.
- Cuk, Katarina, et al. "Circulating microRNAs in plasma as early detection markers for breast cancer." International journal of cancer 132.7 (2013): 1602-1612.
Colorectal Cancer
- Liu, Mulin, et al. "Downregulation of microRNA-409-3p promotes aggressiveness and metastasis in colorectal cancer: an indication for personalized medicine." Journal of translational medicine 13.1 (2015): 1-9.
- Bai, Rongpan, et al. "Micro RNA‐409‐3p suppresses colorectal cancer invasion and metastasis partly by targeting GAB1 expression." International journal of cancer 137.10 (2015): 2310-2322.
- Wang, Shuyang, et al. "A plasma microRNA panel for early detection of colorectal cancer." International journal of cancer 136.1 (2015): 152-161.
- Tan, Shifan, et al. "miR-409-3p sensitizes colon cancer cells to oxaliplatin by inhibiting Beclin-1-mediated autophagy." International journal of molecular medicine 37.4 (2016): 1030-1038.
- Han, Wei, et al. "Curcumin Regulates ERCC1 Expression and Enhances Oxaliplatin Sensitivity in Resistant Colorectal Cancer Cells through Its Effects on miR-409-3p." Evidence-Based Complementary and Alternative Medicine 2020 (2020).
- Long, Jiali, et al. "The effect of miRNA and autophagy on colorectal cancer." Cell Proliferation 53.10 (2020): e12900.
Parkinson Disease
- Acharya, Shubhra, et al. "Non-coding RNAs in the brain-heart axis: The case of Parkinson’s disease." International Journal of Molecular Sciences 21.18 (2020): 6513.
- Gui, YaXing, et al. "Altered microRNA profiles in cerebrospinal fluid exosome in Parkinson disease and Alzheimer disease." Oncotarget 6.35 (2015): 37043.
- Ravanidis, Stylianos, et al. "Circulating brain‐enriched microRNAs for detection and discrimination of idiopathic and genetic Parkinson's disease." Movement disorders 35.3 (2020): 457-467.
- Roser, Anna Elisa, et al. "Circulating miRNAs as diagnostic biomarkers for Parkinson’s disease." Frontiers in neuroscience 12 (2018): 625.