hsa-miR-204-5p
TOOL miRNA RT-qPCR primer/probe set is an integral part of TOOL miRNA RT-qPCR assay which is based on two-step RT-qPCR to especially target microRNAs. Each TOOLS miRNA RT-qPCR primer/probe set is packaged including two parts: one tube containing the unique designed stem-loop RT primer and the other containing a mix of the qPCR probe, forward, and reverse primers.
Features
Assay information
-
Comprehensive: quantitate only mature miRNAs, not precursors
- Sensitive: sequence-specific primers
- Efficient, simple, and scalable: two-step quantitative RT-PCR assay provides high-quality results in less than three hours
Assay information
|
miRBase Accession Number
|
MIMAT0000265
|
|
Chromosome Location
|
chr9:70810031-70810052 (-)
|
|
Mature miRNA Sequence:
|
UUCCCUUUGUCAUCCUAUGCCU
|
|
Species:
|
Human
|
|
Assay System:
|
Probe-base qPCR assay
|
Design of TOOLS miRNA RT-qPCR assay system
.jpg)
| Product name | miRNA ACC |
|---|---|
| hsa-let-7a-5p | MIMAT0000099 |
| hsa-let-7b-5p | MIMAT0000063 |
| hsa-let-7c-5p | MIMAT0000064 |
| hsa-let-7d-3p | MIMAT0000433 |
| hsa-let-7d-5p | MIMAT0000065 |
| hsa-let-7f-5p | MIMAT0000067 |
| hsa-let-7g-5p | MIMAT0000414 |
| hsa-let-7i-3p | MIMAT0004585 |
| hsa-miR-1-3p | MIMAT0000416 |
| hsa-miR-9-5p | MIMAT0000441 |
| hsa-miR-9-3p | MIMAT0000442 |
| hsa-miR-10a-3p | MIMAT0004555 |
| hsa-miR-10a-5p | MIMAT0000253 |
| hsa-miR-10b-3p | MIMAT0004556 |
| hsa-miR-10b-5p | MIMAT0000254 |
| hsa-miR-15b-3p | MIMAT0004586 |
| hsa-miR-15a-5p | MIMAT0000068 |
| hsa-miR-15b-5p | MIMAT0000417 |
| hsa-miR-16-5p | MIMAT0000069 |
| hsa-miR-17-3p | MIMAT0000071 |
| hsa-miR-17-5p | MIMAT0000070 |
| hsa-miR-18a-5p | MIMAT0000072 |
| hsa-miR-18b-5p | MIMAT0001412 |
| hsa-miR-19a-3p | MIMAT0000073 |
| hsa-miR-19b-3p | MIMAT0000074 |
| hsa-miR-20a-5p | MIMAT0000075 |
| hsa-miR-21-5p | MIMAT0000076 |
| hsa-miR-22-3p | MIMAT0000077 |
| hsa-miR-22-5p | MIMAT0004495 |
| hsa-miR-23a-3p | MIMAT0000078 |
| hsa-miR-23c | MIMAT0018000 |
| hsa-miR-24-1-5p | MIMAT0000079 |
| hsa-miR-24-3p | MIMAT0000080 |
| hsa-miR-25-3p | MIMAT0000081 |
| hsa-miR-25-5p | MIMAT0004498 |
| hsa-miR-26a-5p | MIMAT0000082 |
| hsa-miR-26b-5p | MIMAT0000083 |
| hsa-miR-26a-1-3p | MIMAT0004499 |
| hsa-miR-26a-2-3p | MIMAT0004681 |
| hsa-miR-27a-3p | MIMAT0000084 |
| hsa-miR-27b-3p | MIMAT0000419 |
| hsa-miR-29a-3p | MIMAT0000086 |
| hsa-miR-29a-5p | MIMAT0004503 |
| hsa-miR-29b-2-5p | MIMAT0004515 |
| hsa-miR-29b-3p | MIMAT0000100 |
| hsa-miR-30a-3p | MIMAT0000088 |
| hsa-miR-30a-5p | MIMAT0000087 |
| hsa-miR-30b-5p | MIMAT0000420 |
| hsa-miR-30c-5p | MIMAT0000244 |
| hsa-miR-30d-5p | MIMAT0000245 |
| hsa-miR-30e-5p | MIMAT0000692 |
| hsa-miR-30e-3p | MIMAT0000693 |
| hsa-miR-31-5p | MIMAT0000089 |
| hsa-miR-32-5p | MIMAT0000090 |
| hsa-miR-33a-5p | MIMAT0000091 |
| hsa-miR-34a-5p | MIMAT0000255 |
| hsa-miR-34c-5p | MIMAT0000686 |
| hsa-miR-92a-3p | MIMAT0000092 |
| hsa-miR-92b-3p | MIMAT0003218 |
| hsa-miR-93-5p | MIMAT0000093 |
| hsa-miR-98-5p | MIMAT0000096 |
| hsa-miR-99a-5p | MIMAT0000097 |
| hsa-miR-99b-5p | MIMAT0000689 |
| hsa-miR-100-5p | MIMAT0000098 |
| hsa-miR-101-3p | MIMAT0000099 |
| hsa-miR-101-5p | MIMAT0004513 |
| hsa-miR-103a-3p | MIMAT0000101 |
| hsa-miR-106a-5p | MIMAT0000103 |
| hsa-miR-106b-3p | MIMAT0004672 |
| hsa-miR-106b-5p | MIMAT0000680 |
| hsa-miR-107 | MIMAT0000104 |
| hsa-miR-122-5p | MIMAT0000421 |
| hsa-miR-125a-5p | MIMAT0000443 |
| hsa-miR-125b-5p | MIMAT0000423 |
| hsa-miR-126-5p | MIMAT0000444 |
| hsa-miR-126-3p | MIMAT0000445 |
| hsa-miR-127-3p | MIMAT0000446 |
| hsa-miR-128-3p | MIMAT0000424 |
| hsa-miR-130b-3p | MIMAT0000691 |
| hsa-miR-130b-5p | MIMAT0004680 |
| hsa-miR-132-3p | MIMAT0000426 |
| hsa-miR-133a-3p | MIMAT0000427 |
| hsa-mir-133a-5p | MIMAT0026478 |
| hsa-miR-133b | MIMAT0000770 |
| hsa-miR-135b-5p | MIMAT0000758 |
| hsa-miR-135a-3p | MIMAT0004595 |
| hsa-miR-135a-5p | MIMAT0000428 |
| Product name | miRNA ACC |
|---|---|
| hsa-miR-139-3p | MIMAT0004552 |
| hsa-miR-140-3p | MIMAT0004597 |
| hsa-miR-141-3p | MIMAT0000432 |
| hsa-miR-142-5p | MIMAT0000433 |
| hsa-miR-142-3p | MIMAT0000434 |
| hsa-miR-143-3p | MIMAT0000435 |
| hsa-miR-144-3p | MIMAT0000436 |
| hsa-miR-144-3p | MIMAT0004600 |
| hsa-miR-145-5p | MIMAT0000437 |
| hsa-miR-146a-5p | MIMAT0000449 |
| hsa-miR-148a-3p | MIMAT0000243 |
| hsa-miR-148a-5p | MIMAT0004549 |
| hsa-miR-148b-3p | MIMAT0000759 |
| hsa-miR-149-5p | MIMAT0000450 |
| hsa-miR-150-5p | MIMAT0000451 |
| hsa-miR-151a-3p | MIMAT0000757 |
| hsa-miR-181a-3p | MIMAT0000270 |
| hsa-miR-181a-5p | MIMAT0000256 |
| hsa-miR-181b-5p | MIMAT0000257 |
| hsa-miR-182-5p | MIMAT0000259 |
| hsa-miR-183-5p | MIMAT0000261 |
| hsa-miR-184 | MIMAT0000454 |
| hsa-miR-185-5p | MIMAT0000455 |
| hsa-miR-186-5p | MIMAT0000456 |
| hsa-miR-187-3p | MIMAT0000262 |
| hsa-miR-191-5p | MIMAT0000440 |
| hsa-miR-192-5p | MIMAT0000222 |
| hsa-miR-193a-5p | MIMAT0004614 |
| hsa-miR-193b-3p | MIMAT0002819 |
| hsa-miR-193b-5p | MIMAT0004767 |
| hsa-miR-194-5p | MIMAT0000460 |
| hsa-miR-195-5p | MIMAT0000461 |
| hsa-miR-196a-5p | MIMAT0000226 |
| hsa-miR-196b-5p | MIMAT0001080 |
| hsa-miR-197-3p | MIMAT0000227 |
| hsa-miR-199a-3p | MIMAT0000232 |
| hsa-miR-199b-5p | MIMAT0000263 |
| hsa-miR-200a-3p | MIMAT0000682 |
| hsa-miR-200c-3p | MIMAT0000617 |
| hsa-miR-203a-3p | MIMAT0000264 |
| hsa-mir-204-3p | MIMAT0022693 |
| hsa-miR-204-5p | MIMAT0000265 |
| hsa-miR-205-5p | MIMAT0000266 |
| hsa-miR-208a-3p | MIMAT0000241 |
| hsa-miR-208b-3p | MIMAT0004960 |
| hsa-miR-210-3p | MIMAT0000267 |
| hsa-miR-211-5p | MIMAT0000268 |
| hsa-miR-212-3p | MIMAT0000269 |
| hsa-miR-214-3p | MIMAT0000271 |
| hsa-miR-215-5p | MIMAT0000272 |
| hsa-miR-218-5p | MIMAT0000275 |
| hsa-miR-221-3p | MIMAT0000278 |
| hsa-miR-222-3p | MIMAT0000279 |
| hsa-miR-223-3p | MIMAT0000280 |
| hsa-miR-223-5p | MIMAT0004570 |
| hsa-miR-224-5p | MIMAT0000281 |
| hsa-miR-296-3p | MIMAT0004679 |
| hsa-miR-320a-3p | MIMAT0000510 |
| hsa-miR-320d | MIMAT0006764 |
| hsa-miR-324-3p | MIMAT0000762 |
| hsa-miR-328-3p | MIMAT0000752 |
| hsa-miR-330-3p | MIMAT0000751 |
| hsa-miR-335-3p | MIMAT0004703 |
| hsa-miR-335-5p | MIMAT0000765 |
| hsa-miR-338-3p | MIMAT0000763 |
| hsa-miR-339-3p | MIMAT0004702 |
| hsa-miR-340-5p | MIMAT0004692 |
| hsa-miR-342-3p | MIMAT0000753 |
| hsa-miR-342-5p | MIMAT0004694 |
| hsa-miR-365a-3p | MIMAT0000710 |
| hsa-miR-365a-5p | MIMAT0009199 |
| hsa-miR-367-3p | MIMAT0000719 |
| hsa-miR-374b-5p | MIMAT0004955 |
| hsa-miR-375-3p | MIMAT0000728 |
| hsa-miR-378a-3p | MIMAT0000732 |
| hsa-miR-378a-5p | MIMAT0000731 |
| hsa-mir-409-3p | MIMAT0001639 |
| hsa-miR-421 | MIMAT0003339 |
| hsa-miR-423-3p | MIMAT0001340 |
| hsa-miR-423-5p | MIMAT0004748 |
| hhsa-miR-425-5p | MIMAT0003393 |
| hsa-miR-429 | MIMAT0001536 |
| hsa-miR-450a-5p | MIMAT0001545 |
| hsa-miR-451a | MIMAT0001631 |
| hsa-miR-452-5p | MIMAT0001635 |
| hsa-miR-455-3p | MIMAT0004784 |
| hsa-miR-455-5p | MIMAT0003150 |
| Product name | miRNA ACC |
|---|---|
| hsa-miR-486-3p | MIMAT0004762 |
| hsa-miR-489-3p | MIMAT0002805 |
| hsa-miR-494-3p | MIMAT0002816 |
| hsa-miR-497-5p | MIMAT0002820 |
| hsa-miR-499a-5p | MIMAT0002870 |
| hsa-miR-500a-3p | MIMAT0002871 |
| hsa-miR-501-3p | MIMAT0004774 |
| hsa-miR-502-3p | MIMAT0004775 |
| hsa-miR-506-3p | MIMAT0002878 |
| hsa-miR-508-3p | MIMAT0002880 |
| hsa-miR-509-5p | MIMAT0004779 |
| hsa-miR-514a-3p | MIMAT0002883 |
| hsa-miR-532-5p | MIMAT0002888 |
| hsa-miR-548f-5p | MIMAT0026739 |
| hsa-miR-548h-5p | MIMAT0005928 |
| hsa-miR-548ar-5p | MIMAT0022265 |
| hsa-miR-548aj-5p | MIMAT0022739 |
| hsa-miR-550a-5p | MIMAT0004800 |
| hsa-miR-574-3p | MIMAT0003239 |
| hsa-miR-576-5p | MIMAT0003241 |
| hsa-miR-582-3p | MIMAT0004797 |
| hsa-miR-584-5p | MIMAT0003249 |
| hsa-miR-615-3p | MIMAT0003283 |
| hsa-miR-619-3p | MIMAT0003288 |
| hsa-miR-624-3p | MIMAT0004807 |
| hsa-miR-625-3p | MIMAT0004808 |
| hsa-miR-625-5p | MIMAT0003294 |
| hsa-miR-627-5p | MIMAT0003296 |
| hsa-miR-629-5p | MIMAT0004810 |
| hsa-miR-633 | MIMAT0003303 |
| hsa-miR-640 | MIMAT0003310 |
| hsa-miR-644a | MIMAT0003314 |
| hsa-miR-663a | MIMAT0003326 |
| hsa-miR-664a-3p | MIMAT0005949 |
| hsa-miR-664a-5p | MIMAT0005948 |
| hsa-miR-671-5p | MIMAT0003880 |
| hsa-miR-744-5p | MIMAT0004945 |
| hsa-miR-765 | MIMAT0003945 |
| hsa-miR-877-5p | MIMAT0004949 |
| hsa-miR-888-5p | MIMAT0004916 |
| hsa-miR-933 | MIMAT0004976 |
| hsa-miR-937-3p | MIMAT0004980 |
| hsa-miR-941 | MIMAT0004984 |
| hsa-miR-1180-3p | MIMAT0005825 |
| hsa-miR-1207-5p | MIMAT0005871 |
| hsa-miR-1226-3p | MIMAT0005577 |
| hsa-miR-1227-3p | MIMAT0005580 |
| hsa-miR-1229-3p | MIMAT0005580 |
| hsa-miR-1238-3p | MIMAT0005593 |
| hsa-miR-1246 | MIMAT0005898 |
| hsa-miR-1247-5p | MIMAT0005899 |
| hsa-miR-1276 | MIMAT0005930 |
| hsa-miR-1285-3p | MIMAT0005876 |
| hsa-miR-1291 | MIMAT0005881 |
| hsa-miR-1292-5p | MIMAT0005943 |
| hsa-miR-1307-5p | MIMAT0022727 |
| hsa-miR-1322 | MIMAT0005953 |
| hsa-miR-1909-3p | MIMAT0007883 |
| hsa-miR-2110 | MIMAT0010133 |
| hsa-miR-3150a-5p | MIMAT0019206 |
| hsa-miR-3158-3p | MIMAT0015032 |
| hsa-miR-3166 | MIMAT0015040 |
| hsa-miR-3198 | MIMAT0015083 |
| hsa-miR-3615 | MIMAT0017994 |
| hsa-miR-3688-3p | MIMAT0018116 |
| hsa-miR-4260 | MIMAT0016881 |
| hsa-miR-4301 | MIMAT0016850 |
| hsa-miR-4304 | MIMAT0016854 |
| hsa-miR-4436b-5p | MIMAT0019940 |
| hsa-miR-4454 | MIMAT0018976 |
| hsa-miR-4479 | MIMAT0019011 |
| hsa-miR-4488 | MIMAT0019022 |
| hsa-miR-4732-3p | MIMAT0019856 |
| hsa-miR-4755-3p | MIMAT0019896 |
| hsa-miR-4772-5p | MIMAT0019926 |
| hsa-miR-4793-3p | MIMAT0019966 |
| hsa-miR-5684 | MIMAT0022473 |
| hsa-miR-5693 | MIMAT0022486 |
| hsa-miR-7706 | MIMAT0030021 |
| hsa-miR-7974 | MIMAT0031177 |
| hsa-miR-12136 | MIMAT0049032 |
| cel-miR-238-3p | MIMAT0000293 |
| SNORD48 | NR_002745.1 |
| SNORD44 | NR_002750.2 |
| RNU6B | NR_004394.1 |
| cel-miR-39-3p | MIMAT0000010 |
| cel-miR-54-3p | MIMAT0000025 |
TOOLS miRNA RT Kit
Cat#TTH-mi50 / TTH-mi250
TOOLS miRNA RT Kit provides the perfect first step of TOOLS miRNA RT-qPCR assay. This Kit adopts an innovative RT enzyme and buffer system, which enables the RT reaction completed within only 15 mins, and provides reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template.
Cat#TTH-mi50 / TTH-mi250
TOOLS miRNA RT Kit provides the perfect first step of TOOLS miRNA RT-qPCR assay. This Kit adopts an innovative RT enzyme and buffer system, which enables the RT reaction completed within only 15 mins, and provides reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template.
-
Easy: Compatible with TOOLS miRNA RTqPCR primer/probe set, only common RT procedure required.
-
Fast: RT reaction completed only within 15 mins.
-
Accurate: Combination of an efficient reverse transcriptase and RNase inhibitor
-
Efficient: Reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template
TOOLS Easy 2xProbe qPCR Mix
Cat#TTC-QE13
This optimized ready-to-load mix contains dNTP/dUTP mix, Mg2+, modified hot-start DNA polymerase, dUTP/UDG anticontamination system, specific ROX Reference Dye, and all components necessary to be directly used for a robust and low-template qPCR with high sensitivity, specificity, and reliability. The dUTP/UDG anticontamination system included into the mix eliminates the product contamination of qPCR reactions. TOOLS Easy 2×Probe qPCR Mix also contains ROX Reference Dye suitable for all qPCR instruments, and no adjustments are required for the dye concentration in different instruments.
Cat#TTC-QE13
This optimized ready-to-load mix contains dNTP/dUTP mix, Mg2+, modified hot-start DNA polymerase, dUTP/UDG anticontamination system, specific ROX Reference Dye, and all components necessary to be directly used for a robust and low-template qPCR with high sensitivity, specificity, and reliability. The dUTP/UDG anticontamination system included into the mix eliminates the product contamination of qPCR reactions. TOOLS Easy 2×Probe qPCR Mix also contains ROX Reference Dye suitable for all qPCR instruments, and no adjustments are required for the dye concentration in different instruments.
-
Easy: All-in-one optimized master mix
-
Specific: Premixed with dUTP/UDG anticontamination system
-
High efficiency and stability
-
ROX Reference Dye for fluorescent signal normalization and compatible with all qPCR instruments.
EasyPrep miRNA Extraction Kit
Cat#DPT-BE01
EasyPrep miRNA Extraction Kit utilizes a silica-based system to enrich and purify small RNA, including miRNA, small interfering RNA (siRNA), small nuclear RNA (snRNA), and total RNA from various sample sources (cell, animal tissue, plant tissue, serum, plasma), especially for small RNA of <200 nt. The lysis buffer in the kit is optimized to exert excellent lysis ability and isolation efficiency. High-quality isolated product without contamination of DNA and protein could be obtained within 1 hour, and directly used in Northern Blot, Dot Blot, Poly A screening, in vitro translation, RNase protection analysis, and also molecular cloning.
- Efficient: Completed within 1 hr
- Quality: silica-based system to yield high-purity small RNA product
- Flexible: Excellent lysis ability for various sample sources
Breast Cancer
- Toda, Hiroko, et al. "Molecular pathogenesis of triple-negative breast cancer based on microRNA expression signatures: Antitumor miR-204-5p targets AP1S3." Journal of human genetics 63.12 (2018): 1197-1210.
- Hong, Bok Sil, et al. "Tumor suppressor miRNA-204-5p regulates growth, metastasis, and immune microenvironment remodeling in breast cancer." Cancer research 79.7 (2019): 1520-1534.
- Zeng, Jun, et al. "MiR-204-5p/Six1 feedback loop promotes epithelial–mesenchymal transition in breast cancer." Tumor Biology 37.2 (2016): 2729-2735.
- Liang, Wen‐Hui, et al. "DSCAM‐AS1 promotes tumor growth of breast cancer by reducing miR‐204‐5p and up‐regulating RRM2." Molecular carcinogenesis 58.4 (2019): 461-473.
Colorectal Cancer
- Yin, Yuan, et al. "miR-204-5p inhibits proliferation and invasion and enhances chemotherapeutic sensitivity of colorectal cancer cells by downregulating RAB22A." Clinical cancer research 20.23 (2014): 6187-6199.
- Sümbül, Ahmet Taner, et al. "miR-204-5p expression in colorectal cancer: an autophagy-associated gene." Tumor Biology 35.12 (2014): 12713-12719.
- Bian, Zehua, et al. "LncRNA—UCA1 enhances cell proliferation and 5-fluorouracil resistance in colorectal cancer by inhibiting miR-204-5p." Scientific reports 6.1 (2016): 1-12.
- Shuai, Feng, Bo Wang, and Shuxiao Dong. "MicroRNA-204 inhibits the growth and motility of colorectal cancer cells by downregulation of CXCL8." Oncology Research Featuring Preclinical and Clinical Cancer Therapeutics 26.8 (2018): 1295-1305.
Parkinson Disease
- Martinez, Bridget, and Philip V. Peplow. "MicroRNAs in Parkinson's disease and emerging therapeutic targets." Neural Regeneration Research 12.12 (2017): 1945.
- Talepoor Ardakani, Maryam, et al. "Upregulation of miR‐200a and miR‐204 in MPP+‐treated differentiated PC12 cells as a model of Parkinson’s disease." Molecular genetics & genomic medicine 7.3 (2019): e548.
- Zhou, Shufang, et al. "Long non‐coding RNA NORAD functions as a microRNA‐204‐5p sponge to repress the progression of Parkinson's disease in vitro by increasing the solute carrier family 5 member 3 expression." IUBMB life 72.9 (2020): 2045-2055.