hsa-miR-141-3p
TOOL miRNA RT-qPCR primer/probe set is an integral part of TOOL miRNA RT-qPCR assay which is based on two-step RT-qPCR to especially target microRNAs. Each TOOLS miRNA RT-qPCR primer/probe set is packaged including two parts: one tube containing the unique designed stem-loop RT primer and the other containing a mix of the qPCR probe, forward, and reverse primers.
Features
Assay information
-
Comprehensive: quantitate only mature miRNAs, not precursors
- Sensitive: sequence-specific primers
- Efficient, simple, and scalable: two-step quantitative RT-PCR assay provides high-quality results in less than three hours
Assay information
miRBase Accession Number
|
MIMAT0000432
|
Chromosome Location
|
chr12:6964155-6964176 (+)
|
Mature miRNA Sequence:
|
UAACACUGUCUGGUAAAGAUGG
|
Species:
|
Human
|
Assay System:
|
Probe-base qPCR assay
|
Design of TOOLS miRNA RT-qPCR assay system
.jpg)
Product name | miRNA ACC |
---|---|
hsa-let-7a-5p | MIMAT0000099 |
hsa-let-7b-5p | MIMAT0000063 |
hsa-let-7c-5p | MIMAT0000064 |
hsa-let-7d-3p | MIMAT0000433 |
hsa-let-7d-5p | MIMAT0000065 |
hsa-let-7f-5p | MIMAT0000067 |
hsa-let-7g-5p | MIMAT0000414 |
hsa-let-7i-3p | MIMAT0004585 |
hsa-miR-1-3p | MIMAT0000416 |
hsa-miR-9-5p | MIMAT0000441 |
hsa-miR-9-3p | MIMAT0000442 |
hsa-miR-10a-3p | MIMAT0004555 |
hsa-miR-10a-5p | MIMAT0000253 |
hsa-miR-10b-3p | MIMAT0004556 |
hsa-miR-10b-5p | MIMAT0000254 |
hsa-miR-15b-3p | MIMAT0004586 |
hsa-miR-15a-5p | MIMAT0000068 |
hsa-miR-15b-5p | MIMAT0000417 |
hsa-miR-16-5p | MIMAT0000069 |
hsa-miR-17-3p | MIMAT0000071 |
hsa-miR-17-5p | MIMAT0000070 |
hsa-miR-18a-5p | MIMAT0000072 |
hsa-miR-18b-5p | MIMAT0001412 |
hsa-miR-19a-3p | MIMAT0000073 |
hsa-miR-19b-3p | MIMAT0000074 |
hsa-miR-20a-5p | MIMAT0000075 |
hsa-miR-21-5p | MIMAT0000076 |
hsa-miR-22-3p | MIMAT0000077 |
hsa-miR-22-5p | MIMAT0004495 |
hsa-miR-23a-3p | MIMAT0000078 |
hsa-miR-23c | MIMAT0018000 |
hsa-miR-24-1-5p | MIMAT0000079 |
hsa-miR-24-3p | MIMAT0000080 |
hsa-miR-25-3p | MIMAT0000081 |
hsa-miR-25-5p | MIMAT0004498 |
hsa-miR-26a-5p | MIMAT0000082 |
hsa-miR-26b-5p | MIMAT0000083 |
hsa-miR-26a-1-3p | MIMAT0004499 |
hsa-miR-26a-2-3p | MIMAT0004681 |
hsa-miR-27a-3p | MIMAT0000084 |
hsa-miR-27b-3p | MIMAT0000419 |
hsa-miR-29a-3p | MIMAT0000086 |
hsa-miR-29a-5p | MIMAT0004503 |
hsa-miR-29b-2-5p | MIMAT0004515 |
hsa-miR-29b-3p | MIMAT0000100 |
hsa-miR-30a-3p | MIMAT0000088 |
hsa-miR-30a-5p | MIMAT0000087 |
hsa-miR-30b-5p | MIMAT0000420 |
hsa-miR-30c-5p | MIMAT0000244 |
hsa-miR-30d-5p | MIMAT0000245 |
hsa-miR-30e-5p | MIMAT0000692 |
hsa-miR-30e-3p | MIMAT0000693 |
hsa-miR-31-5p | MIMAT0000089 |
hsa-miR-32-5p | MIMAT0000090 |
hsa-miR-33a-5p | MIMAT0000091 |
hsa-miR-34a-5p | MIMAT0000255 |
hsa-miR-34c-5p | MIMAT0000686 |
hsa-miR-92a-3p | MIMAT0000092 |
hsa-miR-92b-3p | MIMAT0003218 |
hsa-miR-93-5p | MIMAT0000093 |
hsa-miR-98-5p | MIMAT0000096 |
hsa-miR-99a-5p | MIMAT0000097 |
hsa-miR-99b-5p | MIMAT0000689 |
hsa-miR-100-5p | MIMAT0000098 |
hsa-miR-101-3p | MIMAT0000099 |
hsa-miR-101-5p | MIMAT0004513 |
hsa-miR-103a-3p | MIMAT0000101 |
hsa-miR-106a-5p | MIMAT0000103 |
hsa-miR-106b-3p | MIMAT0004672 |
hsa-miR-106b-5p | MIMAT0000680 |
hsa-miR-107 | MIMAT0000104 |
hsa-miR-122-5p | MIMAT0000421 |
hsa-miR-125a-5p | MIMAT0000443 |
hsa-miR-125b-5p | MIMAT0000423 |
hsa-miR-126-5p | MIMAT0000444 |
hsa-miR-126-3p | MIMAT0000445 |
hsa-miR-127-3p | MIMAT0000446 |
hsa-miR-128-3p | MIMAT0000424 |
hsa-miR-130b-3p | MIMAT0000691 |
hsa-miR-130b-5p | MIMAT0004680 |
hsa-miR-132-3p | MIMAT0000426 |
hsa-miR-133a-3p | MIMAT0000427 |
hsa-mir-133a-5p | MIMAT0026478 |
hsa-miR-133b | MIMAT0000770 |
hsa-miR-135b-5p | MIMAT0000758 |
hsa-miR-135a-3p | MIMAT0004595 |
hsa-miR-135a-5p | MIMAT0000428 |
Product name | miRNA ACC |
---|---|
hsa-miR-139-3p | MIMAT0004552 |
hsa-miR-140-3p | MIMAT0004597 |
hsa-miR-141-3p | MIMAT0000432 |
hsa-miR-142-5p | MIMAT0000433 |
hsa-miR-142-3p | MIMAT0000434 |
hsa-miR-143-3p | MIMAT0000435 |
hsa-miR-144-3p | MIMAT0000436 |
hsa-miR-144-3p | MIMAT0004600 |
hsa-miR-145-5p | MIMAT0000437 |
hsa-miR-146a-5p | MIMAT0000449 |
hsa-miR-148a-3p | MIMAT0000243 |
hsa-miR-148a-5p | MIMAT0004549 |
hsa-miR-148b-3p | MIMAT0000759 |
hsa-miR-149-5p | MIMAT0000450 |
hsa-miR-150-5p | MIMAT0000451 |
hsa-miR-151a-3p | MIMAT0000757 |
hsa-miR-181a-3p | MIMAT0000270 |
hsa-miR-181a-5p | MIMAT0000256 |
hsa-miR-181b-5p | MIMAT0000257 |
hsa-miR-182-5p | MIMAT0000259 |
hsa-miR-183-5p | MIMAT0000261 |
hsa-miR-184 | MIMAT0000454 |
hsa-miR-185-5p | MIMAT0000455 |
hsa-miR-186-5p | MIMAT0000456 |
hsa-miR-187-3p | MIMAT0000262 |
hsa-miR-191-5p | MIMAT0000440 |
hsa-miR-192-5p | MIMAT0000222 |
hsa-miR-193a-5p | MIMAT0004614 |
hsa-miR-193b-3p | MIMAT0002819 |
hsa-miR-193b-5p | MIMAT0004767 |
hsa-miR-194-5p | MIMAT0000460 |
hsa-miR-195-5p | MIMAT0000461 |
hsa-miR-196a-5p | MIMAT0000226 |
hsa-miR-196b-5p | MIMAT0001080 |
hsa-miR-197-3p | MIMAT0000227 |
hsa-miR-199a-3p | MIMAT0000232 |
hsa-miR-199b-5p | MIMAT0000263 |
hsa-miR-200a-3p | MIMAT0000682 |
hsa-miR-200c-3p | MIMAT0000617 |
hsa-miR-203a-3p | MIMAT0000264 |
hsa-mir-204-3p | MIMAT0022693 |
hsa-miR-204-5p | MIMAT0000265 |
hsa-miR-205-5p | MIMAT0000266 |
hsa-miR-208a-3p | MIMAT0000241 |
hsa-miR-208b-3p | MIMAT0004960 |
hsa-miR-210-3p | MIMAT0000267 |
hsa-miR-211-5p | MIMAT0000268 |
hsa-miR-212-3p | MIMAT0000269 |
hsa-miR-214-3p | MIMAT0000271 |
hsa-miR-215-5p | MIMAT0000272 |
hsa-miR-218-5p | MIMAT0000275 |
hsa-miR-221-3p | MIMAT0000278 |
hsa-miR-222-3p | MIMAT0000279 |
hsa-miR-223-3p | MIMAT0000280 |
hsa-miR-223-5p | MIMAT0004570 |
hsa-miR-224-5p | MIMAT0000281 |
hsa-miR-296-3p | MIMAT0004679 |
hsa-miR-320a-3p | MIMAT0000510 |
hsa-miR-320d | MIMAT0006764 |
hsa-miR-324-3p | MIMAT0000762 |
hsa-miR-328-3p | MIMAT0000752 |
hsa-miR-330-3p | MIMAT0000751 |
hsa-miR-335-3p | MIMAT0004703 |
hsa-miR-335-5p | MIMAT0000765 |
hsa-miR-338-3p | MIMAT0000763 |
hsa-miR-339-3p | MIMAT0004702 |
hsa-miR-340-5p | MIMAT0004692 |
hsa-miR-342-3p | MIMAT0000753 |
hsa-miR-342-5p | MIMAT0004694 |
hsa-miR-365a-3p | MIMAT0000710 |
hsa-miR-365a-5p | MIMAT0009199 |
hsa-miR-367-3p | MIMAT0000719 |
hsa-miR-374b-5p | MIMAT0004955 |
hsa-miR-375-3p | MIMAT0000728 |
hsa-miR-378a-3p | MIMAT0000732 |
hsa-miR-378a-5p | MIMAT0000731 |
hsa-mir-409-3p | MIMAT0001639 |
hsa-miR-421 | MIMAT0003339 |
hsa-miR-423-3p | MIMAT0001340 |
hsa-miR-423-5p | MIMAT0004748 |
hhsa-miR-425-5p | MIMAT0003393 |
hsa-miR-429 | MIMAT0001536 |
hsa-miR-450a-5p | MIMAT0001545 |
hsa-miR-451a | MIMAT0001631 |
hsa-miR-452-5p | MIMAT0001635 |
hsa-miR-455-3p | MIMAT0004784 |
hsa-miR-455-5p | MIMAT0003150 |
Product name | miRNA ACC |
---|---|
hsa-miR-486-3p | MIMAT0004762 |
hsa-miR-489-3p | MIMAT0002805 |
hsa-miR-494-3p | MIMAT0002816 |
hsa-miR-497-5p | MIMAT0002820 |
hsa-miR-499a-5p | MIMAT0002870 |
hsa-miR-500a-3p | MIMAT0002871 |
hsa-miR-501-3p | MIMAT0004774 |
hsa-miR-502-3p | MIMAT0004775 |
hsa-miR-506-3p | MIMAT0002878 |
hsa-miR-508-3p | MIMAT0002880 |
hsa-miR-509-5p | MIMAT0004779 |
hsa-miR-514a-3p | MIMAT0002883 |
hsa-miR-532-5p | MIMAT0002888 |
hsa-miR-548f-5p | MIMAT0026739 |
hsa-miR-548h-5p | MIMAT0005928 |
hsa-miR-548ar-5p | MIMAT0022265 |
hsa-miR-548aj-5p | MIMAT0022739 |
hsa-miR-550a-5p | MIMAT0004800 |
hsa-miR-574-3p | MIMAT0003239 |
hsa-miR-576-5p | MIMAT0003241 |
hsa-miR-582-3p | MIMAT0004797 |
hsa-miR-584-5p | MIMAT0003249 |
hsa-miR-615-3p | MIMAT0003283 |
hsa-miR-619-3p | MIMAT0003288 |
hsa-miR-624-3p | MIMAT0004807 |
hsa-miR-625-3p | MIMAT0004808 |
hsa-miR-625-5p | MIMAT0003294 |
hsa-miR-627-5p | MIMAT0003296 |
hsa-miR-629-5p | MIMAT0004810 |
hsa-miR-633 | MIMAT0003303 |
hsa-miR-640 | MIMAT0003310 |
hsa-miR-644a | MIMAT0003314 |
hsa-miR-663a | MIMAT0003326 |
hsa-miR-664a-3p | MIMAT0005949 |
hsa-miR-664a-5p | MIMAT0005948 |
hsa-miR-671-5p | MIMAT0003880 |
hsa-miR-744-5p | MIMAT0004945 |
hsa-miR-765 | MIMAT0003945 |
hsa-miR-877-5p | MIMAT0004949 |
hsa-miR-888-5p | MIMAT0004916 |
hsa-miR-933 | MIMAT0004976 |
hsa-miR-937-3p | MIMAT0004980 |
hsa-miR-941 | MIMAT0004984 |
hsa-miR-1180-3p | MIMAT0005825 |
hsa-miR-1207-5p | MIMAT0005871 |
hsa-miR-1226-3p | MIMAT0005577 |
hsa-miR-1227-3p | MIMAT0005580 |
hsa-miR-1229-3p | MIMAT0005580 |
hsa-miR-1238-3p | MIMAT0005593 |
hsa-miR-1246 | MIMAT0005898 |
hsa-miR-1247-5p | MIMAT0005899 |
hsa-miR-1276 | MIMAT0005930 |
hsa-miR-1285-3p | MIMAT0005876 |
hsa-miR-1291 | MIMAT0005881 |
hsa-miR-1292-5p | MIMAT0005943 |
hsa-miR-1307-5p | MIMAT0022727 |
hsa-miR-1322 | MIMAT0005953 |
hsa-miR-1909-3p | MIMAT0007883 |
hsa-miR-2110 | MIMAT0010133 |
hsa-miR-3150a-5p | MIMAT0019206 |
hsa-miR-3158-3p | MIMAT0015032 |
hsa-miR-3166 | MIMAT0015040 |
hsa-miR-3198 | MIMAT0015083 |
hsa-miR-3615 | MIMAT0017994 |
hsa-miR-3688-3p | MIMAT0018116 |
hsa-miR-4260 | MIMAT0016881 |
hsa-miR-4301 | MIMAT0016850 |
hsa-miR-4304 | MIMAT0016854 |
hsa-miR-4436b-5p | MIMAT0019940 |
hsa-miR-4454 | MIMAT0018976 |
hsa-miR-4479 | MIMAT0019011 |
hsa-miR-4488 | MIMAT0019022 |
hsa-miR-4732-3p | MIMAT0019856 |
hsa-miR-4755-3p | MIMAT0019896 |
hsa-miR-4772-5p | MIMAT0019926 |
hsa-miR-4793-3p | MIMAT0019966 |
hsa-miR-5684 | MIMAT0022473 |
hsa-miR-5693 | MIMAT0022486 |
hsa-miR-7706 | MIMAT0030021 |
hsa-miR-7974 | MIMAT0031177 |
hsa-miR-12136 | MIMAT0049032 |
cel-miR-238-3p | MIMAT0000293 |
SNORD48 | NR_002745.1 |
SNORD44 | NR_002750.2 |
RNU6B | NR_004394.1 |
cel-miR-39-3p | MIMAT0000010 |
cel-miR-54-3p | MIMAT0000025 |
TOOLS miRNA RT Kit
Cat#TTH-mi50 / TTH-mi250
TOOLS miRNA RT Kit provides the perfect first step of TOOLS miRNA RT-qPCR assay. This Kit adopts an innovative RT enzyme and buffer system, which enables the RT reaction completed within only 15 mins, and provides reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template.
Cat#TTH-mi50 / TTH-mi250
TOOLS miRNA RT Kit provides the perfect first step of TOOLS miRNA RT-qPCR assay. This Kit adopts an innovative RT enzyme and buffer system, which enables the RT reaction completed within only 15 mins, and provides reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template.
-
Easy: Compatible with TOOLS miRNA RTqPCR primer/probe set, only common RT procedure required.
-
Fast: RT reaction completed only within 15 mins.
-
Accurate: Combination of an efficient reverse transcriptase and RNase inhibitor
-
Efficient: Reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template
TOOLS Easy 2xProbe qPCR Mix
Cat#TTC-QE13
This optimized ready-to-load mix contains dNTP/dUTP mix, Mg2+, modified hot-start DNA polymerase, dUTP/UDG anticontamination system, specific ROX Reference Dye, and all components necessary to be directly used for a robust and low-template qPCR with high sensitivity, specificity, and reliability. The dUTP/UDG anticontamination system included into the mix eliminates the product contamination of qPCR reactions. TOOLS Easy 2×Probe qPCR Mix also contains ROX Reference Dye suitable for all qPCR instruments, and no adjustments are required for the dye concentration in different instruments.
Cat#TTC-QE13
This optimized ready-to-load mix contains dNTP/dUTP mix, Mg2+, modified hot-start DNA polymerase, dUTP/UDG anticontamination system, specific ROX Reference Dye, and all components necessary to be directly used for a robust and low-template qPCR with high sensitivity, specificity, and reliability. The dUTP/UDG anticontamination system included into the mix eliminates the product contamination of qPCR reactions. TOOLS Easy 2×Probe qPCR Mix also contains ROX Reference Dye suitable for all qPCR instruments, and no adjustments are required for the dye concentration in different instruments.
-
Easy: All-in-one optimized master mix
-
Specific: Premixed with dUTP/UDG anticontamination system
-
High efficiency and stability
-
ROX Reference Dye for fluorescent signal normalization and compatible with all qPCR instruments.
EasyPrep miRNA Extraction Kit
Cat#DPT-BE01
EasyPrep miRNA Extraction Kit utilizes a silica-based system to enrich and purify small RNA, including miRNA, small interfering RNA (siRNA), small nuclear RNA (snRNA), and total RNA from various sample sources (cell, animal tissue, plant tissue, serum, plasma), especially for small RNA of <200 nt. The lysis buffer in the kit is optimized to exert excellent lysis ability and isolation efficiency. High-quality isolated product without contamination of DNA and protein could be obtained within 1 hour, and directly used in Northern Blot, Dot Blot, Poly A screening, in vitro translation, RNase protection analysis, and also molecular cloning.
- Efficient: Completed within 1 hr
- Quality: silica-based system to yield high-purity small RNA product
- Flexible: Excellent lysis ability for various sample sources
Breast Cancer
- Song, Wenqing, et al. "The microRNA‐141‐3p/CDK8 pathway regulates the chemosensitivity of breast cancer cells to trastuzumab." Journal of cellular biochemistry 120.8 (2019): 14095-14106.
- Zhang, Yang, et al. "Down-regulation of lncRNA-ATB inhibits epithelial–mesenchymal transition of breast cancer cells by increasing miR-141-3p expression." Biochemistry and Cell Biology 97.2 (2019): 193-200.
- Elango, Ramesh, et al. "MicroRNA expression profiling on paired primary and lymph node metastatic breast cancer revealed distinct microRNA profile associated with LNM." Frontiers in Oncology 10 (2020): 756.
- Taha, Mohamed, et al. "Potential Diagnostic and Prognostic Utility of miR-141, miR-181b1, and miR-23b in Breast Cancer." International journal of molecular sciences 21.22 (2020): 8589.
- Petri, Belinda J., and Carolyn M. Klinge. "Regulation of breast cancer metastasis signaling by miRNAs." Cancer and Metastasis Reviews 39.3 (2020): 837-886.
Colorectal Cancer
- Ardila, Héctor Javier, et al. "Circulating miR‑141‑3p, miR‑143‑3p and miR‑200c‑3p are differentially expressed in colorectal cancer and advanced adenomas." Molecular and clinical oncology 11.2 (2019): 201-207.
- Xing, Yanpeng, et al. "MicroRNA-141-3p affected proliferation, chemosensitivity, migration and invasion of colorectal cancer cells by targeting EGFR." The international journal of biochemistry & cell biology 118 (2020): 105643.
- Liang, Zhi, et al. "MiR-141–3p inhibits cell proliferation, migration and invasion by targeting TRAF5 in colorectal cancer." Biochemical and biophysical research communications 514.3 (2019): 699-705.
- Meltzer, Sebastian, et al. "Circulating exosomal miR-141-3p and miR-375 in metastatic progression of rectal cancer." Translational oncology 12.8 (2019): 1038-1044.
- Moon, Sung Ung, et al. "Theragnosis by a miR-141-3p molecular beacon: simultaneous detection and sensitization of 5-fluorouracil resistant colorectal cancer cells through the activation of the TRIM13-associated apoptotic pathway." Chemical Communications 55.52 (2019): 7466-7469.
- Wu, Guanghai, et al. "Long noncoding RNA ZEB1-AS1 acts as a Sponge of miR-141-3p to Inhibit Cell Proliferation in Colorectal Cancer." International Journal of Medical Sciences 17.11 (2020): 1589.