hsa-miR-142-3p
TOOL miRNA RT-qPCR primer/probe set is an integral part of TOOL miRNA RT-qPCR assay which is based on two-step RT-qPCR to especially target microRNAs. Each TOOLS miRNA RT-qPCR primer/probe set is packaged including two parts: one tube containing the unique designed stem-loop RT primer and the other containing a mix of the qPCR probe, forward, and reverse primers.
Features
Assay information
-
Comprehensive: quantitate only mature miRNAs, not precursors
- Sensitive: sequence-specific primers
- Efficient, simple, and scalable: two-step quantitative RT-PCR assay provides high-quality results in less than three hours
Assay information
miRBase Accession Number
|
MIMAT0000434
|
Chromosome Location
|
chr17:58331245-58331267 (-) |
Mature miRNA Sequence:
|
UGUAGUGUUUCCUACUUUAUGGA
|
Species:
|
Human
|
Assay System:
|
Probe-base qPCR assay
|
Design of TOOLS miRNA RT-qPCR assay system
.jpg)
Product name | miRNA ACC |
---|---|
hsa-let-7a-5p | MIMAT0000099 |
hsa-let-7b-5p | MIMAT0000063 |
hsa-let-7c-5p | MIMAT0000064 |
hsa-let-7d-3p | MIMAT0000433 |
hsa-let-7d-5p | MIMAT0000065 |
hsa-let-7f-5p | MIMAT0000067 |
hsa-let-7g-5p | MIMAT0000414 |
hsa-let-7i-3p | MIMAT0004585 |
hsa-miR-1-3p | MIMAT0000416 |
hsa-miR-9-5p | MIMAT0000441 |
hsa-miR-9-3p | MIMAT0000442 |
hsa-miR-10a-3p | MIMAT0004555 |
hsa-miR-10a-5p | MIMAT0000253 |
hsa-miR-10b-3p | MIMAT0004556 |
hsa-miR-10b-5p | MIMAT0000254 |
hsa-miR-15b-3p | MIMAT0004586 |
hsa-miR-15a-5p | MIMAT0000068 |
hsa-miR-15b-5p | MIMAT0000417 |
hsa-miR-16-5p | MIMAT0000069 |
hsa-miR-17-3p | MIMAT0000071 |
hsa-miR-17-5p | MIMAT0000070 |
hsa-miR-18a-5p | MIMAT0000072 |
hsa-miR-18b-5p | MIMAT0001412 |
hsa-miR-19a-3p | MIMAT0000073 |
hsa-miR-19b-3p | MIMAT0000074 |
hsa-miR-20a-5p | MIMAT0000075 |
hsa-miR-21-5p | MIMAT0000076 |
hsa-miR-22-3p | MIMAT0000077 |
hsa-miR-22-5p | MIMAT0004495 |
hsa-miR-23a-3p | MIMAT0000078 |
hsa-miR-23c | MIMAT0018000 |
hsa-miR-24-1-5p | MIMAT0000079 |
hsa-miR-24-3p | MIMAT0000080 |
hsa-miR-25-3p | MIMAT0000081 |
hsa-miR-25-5p | MIMAT0004498 |
hsa-miR-26a-5p | MIMAT0000082 |
hsa-miR-26b-5p | MIMAT0000083 |
hsa-miR-26a-1-3p | MIMAT0004499 |
hsa-miR-26a-2-3p | MIMAT0004681 |
hsa-miR-27a-3p | MIMAT0000084 |
hsa-miR-27b-3p | MIMAT0000419 |
hsa-miR-29a-3p | MIMAT0000086 |
hsa-miR-29a-5p | MIMAT0004503 |
hsa-miR-29b-2-5p | MIMAT0004515 |
hsa-miR-29b-3p | MIMAT0000100 |
hsa-miR-30a-3p | MIMAT0000088 |
hsa-miR-30a-5p | MIMAT0000087 |
hsa-miR-30b-5p | MIMAT0000420 |
hsa-miR-30c-5p | MIMAT0000244 |
hsa-miR-30d-5p | MIMAT0000245 |
hsa-miR-30e-5p | MIMAT0000692 |
hsa-miR-30e-3p | MIMAT0000693 |
hsa-miR-31-5p | MIMAT0000089 |
hsa-miR-32-5p | MIMAT0000090 |
hsa-miR-33a-5p | MIMAT0000091 |
hsa-miR-34a-5p | MIMAT0000255 |
hsa-miR-34c-5p | MIMAT0000686 |
hsa-miR-92a-3p | MIMAT0000092 |
hsa-miR-92b-3p | MIMAT0003218 |
hsa-miR-93-5p | MIMAT0000093 |
hsa-miR-98-5p | MIMAT0000096 |
hsa-miR-99a-5p | MIMAT0000097 |
hsa-miR-99b-5p | MIMAT0000689 |
hsa-miR-100-5p | MIMAT0000098 |
hsa-miR-101-3p | MIMAT0000099 |
hsa-miR-101-5p | MIMAT0004513 |
hsa-miR-103a-3p | MIMAT0000101 |
hsa-miR-106a-5p | MIMAT0000103 |
hsa-miR-106b-3p | MIMAT0004672 |
hsa-miR-106b-5p | MIMAT0000680 |
hsa-miR-107 | MIMAT0000104 |
hsa-miR-122-5p | MIMAT0000421 |
hsa-miR-125a-5p | MIMAT0000443 |
hsa-miR-125b-5p | MIMAT0000423 |
hsa-miR-126-5p | MIMAT0000444 |
hsa-miR-126-3p | MIMAT0000445 |
hsa-miR-127-3p | MIMAT0000446 |
hsa-miR-128-3p | MIMAT0000424 |
hsa-miR-130b-3p | MIMAT0000691 |
hsa-miR-130b-5p | MIMAT0004680 |
hsa-miR-132-3p | MIMAT0000426 |
hsa-miR-133a-3p | MIMAT0000427 |
hsa-mir-133a-5p | MIMAT0026478 |
hsa-miR-133b | MIMAT0000770 |
hsa-miR-135b-5p | MIMAT0000758 |
hsa-miR-135a-3p | MIMAT0004595 |
hsa-miR-135a-5p | MIMAT0000428 |
Product name | miRNA ACC |
---|---|
hsa-miR-139-3p | MIMAT0004552 |
hsa-miR-140-3p | MIMAT0004597 |
hsa-miR-141-3p | MIMAT0000432 |
hsa-miR-142-5p | MIMAT0000433 |
hsa-miR-142-3p | MIMAT0000434 |
hsa-miR-143-3p | MIMAT0000435 |
hsa-miR-144-3p | MIMAT0000436 |
hsa-miR-144-3p | MIMAT0004600 |
hsa-miR-145-5p | MIMAT0000437 |
hsa-miR-146a-5p | MIMAT0000449 |
hsa-miR-148a-3p | MIMAT0000243 |
hsa-miR-148a-5p | MIMAT0004549 |
hsa-miR-148b-3p | MIMAT0000759 |
hsa-miR-149-5p | MIMAT0000450 |
hsa-miR-150-5p | MIMAT0000451 |
hsa-miR-151a-3p | MIMAT0000757 |
hsa-miR-181a-3p | MIMAT0000270 |
hsa-miR-181a-5p | MIMAT0000256 |
hsa-miR-181b-5p | MIMAT0000257 |
hsa-miR-182-5p | MIMAT0000259 |
hsa-miR-183-5p | MIMAT0000261 |
hsa-miR-184 | MIMAT0000454 |
hsa-miR-185-5p | MIMAT0000455 |
hsa-miR-186-5p | MIMAT0000456 |
hsa-miR-187-3p | MIMAT0000262 |
hsa-miR-191-5p | MIMAT0000440 |
hsa-miR-192-5p | MIMAT0000222 |
hsa-miR-193a-5p | MIMAT0004614 |
hsa-miR-193b-3p | MIMAT0002819 |
hsa-miR-193b-5p | MIMAT0004767 |
hsa-miR-194-5p | MIMAT0000460 |
hsa-miR-195-5p | MIMAT0000461 |
hsa-miR-196a-5p | MIMAT0000226 |
hsa-miR-196b-5p | MIMAT0001080 |
hsa-miR-197-3p | MIMAT0000227 |
hsa-miR-199a-3p | MIMAT0000232 |
hsa-miR-199b-5p | MIMAT0000263 |
hsa-miR-200a-3p | MIMAT0000682 |
hsa-miR-200c-3p | MIMAT0000617 |
hsa-miR-203a-3p | MIMAT0000264 |
hsa-mir-204-3p | MIMAT0022693 |
hsa-miR-204-5p | MIMAT0000265 |
hsa-miR-205-5p | MIMAT0000266 |
hsa-miR-208a-3p | MIMAT0000241 |
hsa-miR-208b-3p | MIMAT0004960 |
hsa-miR-210-3p | MIMAT0000267 |
hsa-miR-211-5p | MIMAT0000268 |
hsa-miR-212-3p | MIMAT0000269 |
hsa-miR-214-3p | MIMAT0000271 |
hsa-miR-215-5p | MIMAT0000272 |
hsa-miR-218-5p | MIMAT0000275 |
hsa-miR-221-3p | MIMAT0000278 |
hsa-miR-222-3p | MIMAT0000279 |
hsa-miR-223-3p | MIMAT0000280 |
hsa-miR-223-5p | MIMAT0004570 |
hsa-miR-224-5p | MIMAT0000281 |
hsa-miR-296-3p | MIMAT0004679 |
hsa-miR-320a-3p | MIMAT0000510 |
hsa-miR-320d | MIMAT0006764 |
hsa-miR-324-3p | MIMAT0000762 |
hsa-miR-328-3p | MIMAT0000752 |
hsa-miR-330-3p | MIMAT0000751 |
hsa-miR-335-3p | MIMAT0004703 |
hsa-miR-335-5p | MIMAT0000765 |
hsa-miR-338-3p | MIMAT0000763 |
hsa-miR-339-3p | MIMAT0004702 |
hsa-miR-340-5p | MIMAT0004692 |
hsa-miR-342-3p | MIMAT0000753 |
hsa-miR-342-5p | MIMAT0004694 |
hsa-miR-365a-3p | MIMAT0000710 |
hsa-miR-365a-5p | MIMAT0009199 |
hsa-miR-367-3p | MIMAT0000719 |
hsa-miR-374b-5p | MIMAT0004955 |
hsa-miR-375-3p | MIMAT0000728 |
hsa-miR-378a-3p | MIMAT0000732 |
hsa-miR-378a-5p | MIMAT0000731 |
hsa-mir-409-3p | MIMAT0001639 |
hsa-miR-421 | MIMAT0003339 |
hsa-miR-423-3p | MIMAT0001340 |
hsa-miR-423-5p | MIMAT0004748 |
hhsa-miR-425-5p | MIMAT0003393 |
hsa-miR-429 | MIMAT0001536 |
hsa-miR-450a-5p | MIMAT0001545 |
hsa-miR-451a | MIMAT0001631 |
hsa-miR-452-5p | MIMAT0001635 |
hsa-miR-455-3p | MIMAT0004784 |
hsa-miR-455-5p | MIMAT0003150 |
Product name | miRNA ACC |
---|---|
hsa-miR-486-3p | MIMAT0004762 |
hsa-miR-489-3p | MIMAT0002805 |
hsa-miR-494-3p | MIMAT0002816 |
hsa-miR-497-5p | MIMAT0002820 |
hsa-miR-499a-5p | MIMAT0002870 |
hsa-miR-500a-3p | MIMAT0002871 |
hsa-miR-501-3p | MIMAT0004774 |
hsa-miR-502-3p | MIMAT0004775 |
hsa-miR-506-3p | MIMAT0002878 |
hsa-miR-508-3p | MIMAT0002880 |
hsa-miR-509-5p | MIMAT0004779 |
hsa-miR-514a-3p | MIMAT0002883 |
hsa-miR-532-5p | MIMAT0002888 |
hsa-miR-548f-5p | MIMAT0026739 |
hsa-miR-548h-5p | MIMAT0005928 |
hsa-miR-548ar-5p | MIMAT0022265 |
hsa-miR-548aj-5p | MIMAT0022739 |
hsa-miR-550a-5p | MIMAT0004800 |
hsa-miR-574-3p | MIMAT0003239 |
hsa-miR-576-5p | MIMAT0003241 |
hsa-miR-582-3p | MIMAT0004797 |
hsa-miR-584-5p | MIMAT0003249 |
hsa-miR-615-3p | MIMAT0003283 |
hsa-miR-619-3p | MIMAT0003288 |
hsa-miR-624-3p | MIMAT0004807 |
hsa-miR-625-3p | MIMAT0004808 |
hsa-miR-625-5p | MIMAT0003294 |
hsa-miR-627-5p | MIMAT0003296 |
hsa-miR-629-5p | MIMAT0004810 |
hsa-miR-633 | MIMAT0003303 |
hsa-miR-640 | MIMAT0003310 |
hsa-miR-644a | MIMAT0003314 |
hsa-miR-663a | MIMAT0003326 |
hsa-miR-664a-3p | MIMAT0005949 |
hsa-miR-664a-5p | MIMAT0005948 |
hsa-miR-671-5p | MIMAT0003880 |
hsa-miR-744-5p | MIMAT0004945 |
hsa-miR-765 | MIMAT0003945 |
hsa-miR-877-5p | MIMAT0004949 |
hsa-miR-888-5p | MIMAT0004916 |
hsa-miR-933 | MIMAT0004976 |
hsa-miR-937-3p | MIMAT0004980 |
hsa-miR-941 | MIMAT0004984 |
hsa-miR-1180-3p | MIMAT0005825 |
hsa-miR-1207-5p | MIMAT0005871 |
hsa-miR-1226-3p | MIMAT0005577 |
hsa-miR-1227-3p | MIMAT0005580 |
hsa-miR-1229-3p | MIMAT0005580 |
hsa-miR-1238-3p | MIMAT0005593 |
hsa-miR-1246 | MIMAT0005898 |
hsa-miR-1247-5p | MIMAT0005899 |
hsa-miR-1276 | MIMAT0005930 |
hsa-miR-1285-3p | MIMAT0005876 |
hsa-miR-1291 | MIMAT0005881 |
hsa-miR-1292-5p | MIMAT0005943 |
hsa-miR-1307-5p | MIMAT0022727 |
hsa-miR-1322 | MIMAT0005953 |
hsa-miR-1909-3p | MIMAT0007883 |
hsa-miR-2110 | MIMAT0010133 |
hsa-miR-3150a-5p | MIMAT0019206 |
hsa-miR-3158-3p | MIMAT0015032 |
hsa-miR-3166 | MIMAT0015040 |
hsa-miR-3198 | MIMAT0015083 |
hsa-miR-3615 | MIMAT0017994 |
hsa-miR-3688-3p | MIMAT0018116 |
hsa-miR-4260 | MIMAT0016881 |
hsa-miR-4301 | MIMAT0016850 |
hsa-miR-4304 | MIMAT0016854 |
hsa-miR-4436b-5p | MIMAT0019940 |
hsa-miR-4454 | MIMAT0018976 |
hsa-miR-4479 | MIMAT0019011 |
hsa-miR-4488 | MIMAT0019022 |
hsa-miR-4732-3p | MIMAT0019856 |
hsa-miR-4755-3p | MIMAT0019896 |
hsa-miR-4772-5p | MIMAT0019926 |
hsa-miR-4793-3p | MIMAT0019966 |
hsa-miR-5684 | MIMAT0022473 |
hsa-miR-5693 | MIMAT0022486 |
hsa-miR-7706 | MIMAT0030021 |
hsa-miR-7974 | MIMAT0031177 |
hsa-miR-12136 | MIMAT0049032 |
cel-miR-238-3p | MIMAT0000293 |
SNORD48 | NR_002745.1 |
SNORD44 | NR_002750.2 |
RNU6B | NR_004394.1 |
cel-miR-39-3p | MIMAT0000010 |
cel-miR-54-3p | MIMAT0000025 |
TOOLS miRNA RT Kit
Cat#TTH-mi50 / TTH-mi250
TOOLS miRNA RT Kit provides the perfect first step of TOOLS miRNA RT-qPCR assay. This Kit adopts an innovative RT enzyme and buffer system, which enables the RT reaction completed within only 15 mins, and provides reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template.
Cat#TTH-mi50 / TTH-mi250
TOOLS miRNA RT Kit provides the perfect first step of TOOLS miRNA RT-qPCR assay. This Kit adopts an innovative RT enzyme and buffer system, which enables the RT reaction completed within only 15 mins, and provides reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template.
-
Easy: Compatible with TOOLS miRNA RTqPCR primer/probe set, only common RT procedure required.
-
Fast: RT reaction completed only within 15 mins.
-
Accurate: Combination of an efficient reverse transcriptase and RNase inhibitor
-
Efficient: Reliable reverse transcription to a wide range (from 15 pg to 150 ng) of RNA template
TOOLS Easy 2xProbe qPCR Mix
Cat#TTC-QE13
This optimized ready-to-load mix contains dNTP/dUTP mix, Mg2+, modified hot-start DNA polymerase, dUTP/UDG anticontamination system, specific ROX Reference Dye, and all components necessary to be directly used for a robust and low-template qPCR with high sensitivity, specificity, and reliability. The dUTP/UDG anticontamination system included into the mix eliminates the product contamination of qPCR reactions. TOOLS Easy 2×Probe qPCR Mix also contains ROX Reference Dye suitable for all qPCR instruments, and no adjustments are required for the dye concentration in different instruments.
Cat#TTC-QE13
This optimized ready-to-load mix contains dNTP/dUTP mix, Mg2+, modified hot-start DNA polymerase, dUTP/UDG anticontamination system, specific ROX Reference Dye, and all components necessary to be directly used for a robust and low-template qPCR with high sensitivity, specificity, and reliability. The dUTP/UDG anticontamination system included into the mix eliminates the product contamination of qPCR reactions. TOOLS Easy 2×Probe qPCR Mix also contains ROX Reference Dye suitable for all qPCR instruments, and no adjustments are required for the dye concentration in different instruments.
-
Easy: All-in-one optimized master mix
-
Specific: Premixed with dUTP/UDG anticontamination system
-
High efficiency and stability
-
ROX Reference Dye for fluorescent signal normalization and compatible with all qPCR instruments.
EasyPrep miRNA Extraction Kit
Cat#DPT-BE01
EasyPrep miRNA Extraction Kit utilizes a silica-based system to enrich and purify small RNA, including miRNA, small interfering RNA (siRNA), small nuclear RNA (snRNA), and total RNA from various sample sources (cell, animal tissue, plant tissue, serum, plasma), especially for small RNA of <200 nt. The lysis buffer in the kit is optimized to exert excellent lysis ability and isolation efficiency. High-quality isolated product without contamination of DNA and protein could be obtained within 1 hour, and directly used in Northern Blot, Dot Blot, Poly A screening, in vitro translation, RNase protection analysis, and also molecular cloning.
- Efficient: Completed within 1 hr
- Quality: silica-based system to yield high-purity small RNA product
- Flexible: Excellent lysis ability for various sample sources
Breast Cancer
- Troschel, Fabian M., et al. "miR-142-3p attenuates breast cancer stem cell characteristics and decreases radioresistance in vitro." Tumor Biology 40.8 (2018): 1010428318791887.
- Xu, Tao, et al. "MiR‐142‐3p functions as a tumor suppressor by targeting RAC1/PAK1 pathway in breast cancer." Journal of cellular physiology 235.5 (2020): 4928-4940.
- Mansoori, Behzad, et al. "miR‐142‐3p as tumor suppressor miRNA in the regulation of tumorigenicity, invasion and migration of human breast cancer by targeting Bach‐1 expression." Journal of cellular physiology 234.6 (2019): 9816-9825.
- Ma, Teng, et al. "USP6NL mediated by LINC00689/miR-142-3p promotes the development of triple-negative breast cancer." BMC cancer 20.1 (2020): 1-12.
- Mansoori, Behzad, et al. "miR‐142‐3p is a tumor suppressor that inhibits estrogen receptor expression in ER‐positive breast cancer." Journal of cellular physiology 234.9 (2019): 16043-16053.
- Liang, Lu, et al. "MiR-142-3p enhances chemosensitivity of breast cancer cells and inhibits autophagy by targeting HMGB1." Acta Pharmaceutica Sinica B 10.6 (2020): 1036-1046.
Colorectal Cancer
- Gao, Wencang, Dexiang Pang, and Senquan Yu. "Serum level of miR-142-3p predicts prognostic outcome for colorectal cancer following curative resection." Journal of International Medical Research 47.5 (2019): 2116-2125.
- Gao, Xiang, et al. "MicroRNA-142-3p promotes cellular invasion of colorectal cancer cells by activation of RAC1." Technology in cancer research & treatment 17 (2018): 1533033818790508.
- Shang, Anquan, et al. "Exosomal circPACRGL promotes progression of colorectal cancer via the miR-142-3p/miR-506-3p-TGF-β1 axis." Molecular cancer 19.1 (2020): 1-15.
- Liu, Peng, et al. "MicroRNA-142-3p inhibits tumorigenesis of colorectal cancer via suppressing the activation of Wnt signaling by directly targeting to β-catenin." Frontiers in Oncology 10 (2020): 3339.
Parkinson Disease
- Chen, Lei, et al. "Identification of aberrant circulating mi RNA s in Parkinson's disease plasma samples." Brain and behavior 8.4 (2018): e00941.
- Acharya, Shubhra, et al. "Non-coding RNAs in the brain-heart axis: The case of Parkinson’s disease." International Journal of Molecular Sciences 21.18 (2020): 6513.