MENU

Products

gga-miR-191-5p

User Guide
TOOL miRNA RT-qPCR primer/probe set is an integral part of TOOL miRNA RT-qPCR assay which is based on two-step RT-qPCR to especially target microRNAs. Each TOOLS miRNA RT-qPCR primer/probe set is packaged including two parts: one tube containing the unique designed stem-loop RT primer and the other containing a mix of the qPCR probe, forward, and reverse primers. 
No. Size Price Qty
TTH-G-191-5p 50 rxns. $250.00
TTH-G-191-5p 250 rxns $850.00
The price does not include shipping fee and tax. ORDER
Features
  • Comprehensive: quantitate only mature miRNAs, not precursors
  • Sensitive: sequence-specific primers
  • ​Efficient, simple, and scalable: two-step quantitative RT-PCR assay provides high-quality results in less than three hours

Assay information
miRBase Accession Number MIMAT0049917
Chromosome Location -
Mature miRNA Sequence:
CAACGGAAUCCCAAAAGCAGCUG
Species: Gallus gallus
Assay System: Probe-base qPCR assay
 

Design of TOOLS miRNA RT-qPCR assay system